PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:59999 Links STS-T98033 Homo sapiens chromosome 5, locus C5orf33 Macaca mulatta chromosome 6, locus C6H5orf33 Pan troglodytes chromosome 5, locus LOC461919 Found by e-PCR in sequences from Homo sapiens, Macaca mulatta, Pan troglodytes and Pongo abelii. Primer Information Forward primer: TAAAAAGGTATCAGCACTCTTGG Reverse primer: ACTACCCAGTCGTAAAGTGACA PCR product size: 214 (bp), Homo sapiens    Homo sapiens Name: STS-T98033 Also known as: sts-T98033 Polymorphism info:   Cross References Gene GeneID: 133686   Symbol: C5orf33   Description: chromosome 5 open reading frame 33   Position: 5p13.2 UniGene Hs.600929 Transcribed locus   Hs.81907 Chromosome 5 open reading frame 33 Mapping Information STS-T98033 Sequence Map: Chr 5|Celera Map Viewer   Position: 36080653-36080867 (bp)   STS-T98033 Sequence Map: Chr 5|HuRef Map Viewer   Position: 36145966-36146180 (bp)   STS-T98033 Sequence Map: Chr 5 Map Viewer   Position: 36194974-36195188 (bp)   sts-T98033 GeneMap99-GB4 Map: Chr 5 Map Viewer   Position: 124.17 (cR3000)   Lod score: 0.01   Reference Interval: D5S651-D5S634 Electronic PCR results RefSeq mRNA (2) NM_001085411.1 1387 .. 1601 (215 bp)   NM_153013.3 1148 .. 1362 (215 bp)     mRNA (5) AK055158.1 1120 .. 1334 (215 bp)   AK057950.1 502 .. 716 (215 bp)   BC032912.1 775 .. 989 (215 bp)   BX648388.1 1116 .. 1330 (215 bp)   BC062567.1 1134 .. 1348 (215 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_922596.1 1791167 .. 1791381 (215 bp)   AC_000048.1 36080653 .. 36080867 (215 bp)   NW_001838933.1 488577 .. 488791 (215 bp)   AC_000137.1 36145966 .. 36146180 (215 bp)   NT_006576.16 36184974 .. 36185188 (215 bp)     Genomic (2) AC008807.10 93960 .. 94174 (215 bp)   AC008942.6 36426 .. 36640 (215 bp)     ESTs (5 of 29)[Show All Hits] T98033.1 29 .. 242 (214 bp)   AA599814.1 52 .. 266 (215 bp)   AA630029.1 49 .. 263 (215 bp)   AI051938.1 56 .. 270 (215 bp)   AI216350.1 57 .. 271 (215 bp)     Whole Genome Shotgun sequences (5) AADD01057316.1 15337 .. 15551 (215 bp)   AADC01050217.1 5050 .. 5264 (215 bp)   AADB02008662.1 337647 .. 337861 (215 bp)   ABBA01024164.1 16389 .. 16603 (215 bp)   ABSL01051895.1 16390 .. 16604 (215 bp)     Patent sequences (3) AX408809.1 52 .. 266 (215 bp)   AX713573.1 1120 .. 1334 (215 bp)   BD285796.1 1120 .. 1334 (215 bp)     High Thoughput cDNA sequences (1) BC045565.1 1275 .. 1489 (215 bp)        Macaca mulatta Name: STS-T98033 Polymorphism info:   Cross References Gene GeneID: 704285   Symbol: C6H5orf33   Description: chromosome 5 open reading frame 33 ortholog   Position:   UniGene Mmu.13388 Similar to Y17G7B.10b Mapping Information STS-T98033 Sequence Map: Chr 6 Map Viewer   Position: 35981071-35981286 (bp) Electronic PCR results RefSeq mRNA (1) XM_001092624.1 1453 .. 1668 (216 bp)     Genomic RefSeqs (1) NW_001120957.1 516674 .. 516889 (216 bp)     Whole Genome Shotgun sequences (1) AANU01264422.1 24570 .. 24785 (216 bp)        Pan troglodytes Name: STS-T98033 Polymorphism info:   Cross References Gene GeneID: 461919   Symbol: LOC461919   Description: hypothetical LOC461919   Position:   Mapping Information STS-T98033 Sequence Map: Chr 5 Map Viewer   Position: 79480696-79480910 (bp) Electronic PCR results RefSeq mRNA (1) XM_517804.2 1453 .. 1667 (215 bp)     Genomic RefSeqs (1) NW_001235398.1 9373472 .. 9373686 (215 bp)     Whole Genome Shotgun sequences (2) AADA01315472.1 6983 .. 7197 (215 bp)   AACZ02061356.1 40575 .. 40789 (215 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results RefSeq mRNA (1) NM_001132064.1 1218 .. 1432 (215 bp)     Whole Genome Shotgun sequences (1) ABGA01135482.1 1656 .. 1870 (215 bp)     High Thoughput cDNA sequences (1) CR858726.1 1218 .. 1432 (215 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement