PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:59795 Links A008C33 Homo sapiens chromosome 1, locus METTL13 Found by e-PCR in sequences from Homo sapiens, Papio anubis and Pongo abelii. Primer Information Forward primer: GTTTGGGCTTAAGTATCCTTTAT Reverse primer: GAGTGACAGCCTATGTGC PCR product size: 168 (bp), Homo sapiens    Homo sapiens Name: A008C33 Also known as: Polymorphism info:   Cross References Gene GeneID: 51603   Symbol: METTL13   Description: methyltransferase like 13   Position: 1q24-q25.3 UniGene Hs.494705 KIAA0859 Mapping Information A008C33 Sequence Map: Chr 1|HuRef Map Viewer   Position: 142990329-142990497 (bp)   A008C33 GeneMap99-GB4 Map: Chr 1 Map Viewer   Position: 624.83 (cR3000)   Lod score: 0.73   Reference Interval: D1S2790-D1S2640 Electronic PCR results Genomic RefSeqs (1) NW_001838533.2 34114754 .. 34114922 (169 bp)     Genomic (1) BV180116.1 107 .. 275 (169 bp)     ESTs (5 of 33)[Show All Hits] R05380.1 84 .. 254 (171 bp)   H89315.1 70 .. 238 (169 bp)   AA069808.1 78 .. 246 (169 bp)   AA362648.1 89 .. 258 (170 bp)   AA599767.1 83 .. 251 (169 bp)     Whole Genome Shotgun sequences (2) ABBA01027923.1 99655 .. 99823 (169 bp)   ABSL01055755.1 99592 .. 99760 (169 bp)     Patent sequences (2) BD153501.1 79 .. 247 (169 bp)   AX873439.1 79 .. 247 (169 bp)        Papio anubis   Polymorphism info:   Electronic PCR results ESTs (1) FC127896.1 47 .. 217 (171 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01089625.1 21919 .. 22089 (171 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement