PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:59660 Links RH66503 Homo sapiens chromosome 1, locus SCCPDH Pan troglodytes chromosome 1, locus SCCPDH Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GTTTCCACATACACTCAGACAGGC Reverse primer: GATTGACAGACTCAACAAACACGG PCR product size: 163 (bp), Homo sapiens    Homo sapiens Name: RH66503 Also known as: stSG35973 Polymorphism info:   Cross References Gene GeneID: 51097   Symbol: SCCPDH   Description: saccharopine dehydrogenase (putative)   Position: 1q44 UniGene Hs.498397 Saccharopine dehydrogenase (putative) Mapping Information RH66503 Sequence Map: Chr 1|HuRef Map Viewer   Position: 217319131-217319293 (bp)   RH66503 Sequence Map: Chr 1|Celera Map Viewer   Position: 220222787-220222949 (bp)   RH66503 Sequence Map: Chr 1 Map Viewer   Position: 246930542-246930704 (bp)   stSG35973 NCBI RH Map: Chr 1 Map Viewer   Position: 2001.5 (cR)   Lod score: 1.72   stSG35973 GeneMap99-GB4 Map: Chr 1 Map Viewer   Position: 764.67 (cR3000)   Lod score: 3.00   Reference Interval: D1S423-qTEL Electronic PCR results RefSeq mRNA (1) NM_016002.2 1577 .. 1739 (163 bp)     mRNA (3) AF151807.1 1227 .. 1389 (163 bp)   AK075178.1 1333 .. 1495 (163 bp)   BC026185.2 1238 .. 1400 (163 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_927572.1 3579901 .. 3580063 (163 bp)   AC_000044.1 220222787 .. 220222949 (163 bp)   NW_001838554.1 125788 .. 125950 (163 bp)   AC_000133.1 217319131 .. 217319293 (163 bp)   NT_167186.1 40448321 .. 40448483 (163 bp)     Genomic (1) AL591848.13 101262 .. 101424 (163 bp)     Low-pass Sequence Sampling (from GenBank HTGS division) (1) AC087266.1 25849 .. 26011 (163 bp)     ESTs (5 of 155)[Show All Hits] T99925.1 98 .. 260 (163 bp)   R02421.1 98 .. 260 (163 bp)   R28482.1 67 .. 231 (165 bp)   R74259.1 172 .. 334 (163 bp)   H00584.1 45 .. 207 (163 bp)     Whole Genome Shotgun sequences (4) AADD01014544.1 449 .. 611 (163 bp)   AADB02001337.1 74438 .. 74600 (163 bp)   ABBA01031768.1 42386 .. 42548 (163 bp)   ABSL01057774.1 42397 .. 42559 (163 bp)     Patent sequences (5 of 19)[Show All Hits] AX050429.1 1258 .. 1420 (163 bp)   AX082299.1 1337 .. 1499 (163 bp)   BD126006.1 55 .. 218 (164 bp)   BD127555.1 1333 .. 1495 (163 bp)   AX779918.1 1598 .. 1760 (163 bp)     High Thoughput cDNA sequences (5 of 8)[Show All Hits] CR595124.1 1239 .. 1401 (163 bp)   CR601818.1 1242 .. 1404 (163 bp)   CR602614.1 1239 .. 1401 (163 bp)   CR612370.1 1258 .. 1420 (163 bp)   CR618077.1 1214 .. 1376 (163 bp)        Pan troglodytes Name: RH66503 Polymorphism info:   Cross References Gene GeneID: 469737   Symbol: SCCPDH   Description: saccharopine dehydrogenase (putative)   Position:   Mapping Information RH66503 Sequence Map: Chr 1 Map Viewer   Position: 227867470-227867632 (bp) Electronic PCR results RefSeq mRNA (5) XM_001140056.1 1609 .. 1771 (163 bp)   XM_525121.2 1606 .. 1768 (163 bp)   XM_001139892.1 1608 .. 1770 (163 bp)   XM_001139978.1 1552 .. 1714 (163 bp)   XM_001139637.1 1281 .. 1443 (163 bp)     Genomic RefSeqs (1) NW_001229636.1 3803005 .. 3803167 (163 bp)     Whole Genome Shotgun sequences (2) AADA01139565.1 28974 .. 29136 (163 bp)   AACZ02014937.1 2784 .. 2946 (163 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement