PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:58886 Links D7S2271E Homo sapiens chromosome 7, locus SCRN1 Macaca mulatta chromosome 3, locus SCRN1 Pan troglodytes chromosome 7, locus SCRN1 Found by e-PCR in sequences from Callithrix jacchus, Homo sapiens, Macaca mulatta, Pan troglodytes, Papio anubis and Pongo abelii. Primer Information Forward primer: GTTAAGACTACATGGCCAGTTC Reverse primer: GCTTTTCATTCTGCACAGTC PCR product size: 255-256 (bp), Homo sapiens GenBank Accession: G31727 T03756    Callithrix jacchus   Polymorphism info:   Electronic PCR results ESTs (1) EH382222.1 390 .. 624 (235 bp)        Homo sapiens Name: D7S2271E Also known as: GDB:1221701 IB858 SHGC-2369 sWSS2523 Polymorphism info:   Cross References Gene GeneID: 9805   Symbol: SCRN1   Description: secernin 1   Position: 7p14.3-p14.1 UniGene Hs.520740 Secernin 1   Hs.601501 Transcribed locus Mapping Information D7S2271E Sequence Map: Chr 7|HuRef Map Viewer   Position: 29841516-29841771 (bp)   D7S2271E Sequence Map: Chr 7|Celera Map Viewer   Position: 29949220-29949475 (bp)   D7S2271E Sequence Map: Chr 7 Map Viewer   Position: 29959832-29960087 (bp)   D7S2271E Sequence Map: Chr 7|CRA_TCAGchr7v2 Map Viewer   Position: 30009655-30009910 (bp)   SHGC-2369 GeneMap99-G3 Map: Chr 7 Map Viewer   Position: 1069 (cR10000)   Lod score: F   Reference Interval: D7S529-D7S484   sWSS2523 NHGRI-7 Map: Chr 7     Reference Interval: E :pos244   IB858 Whitehead-YAC Map: Chr 7 Map Viewer   Position: 118 (ordinal)   Reference Interval: WC7.3 Electronic PCR results RefSeq mRNA (4) NM_014766.4 4900 .. 5155 (256 bp)   NM_001145514.1 4840 .. 5095 (256 bp)   NM_001145515.1 4740 .. 4995 (256 bp)   NM_001145513.1 4908 .. 5163 (256 bp)     mRNA (3) G31727.1 106 .. 361 (256 bp)   D83777.2 4843 .. 5098 (256 bp)   BC040492.1 4852 .. 5107 (256 bp)     Genomic RefSeqs (5 of 8)[Show All Hits] NW_923240.1 23120085 .. 23120340 (256 bp)   NT_079592.2 29959655 .. 29959910 (256 bp)   AC_000050.1 29949220 .. 29949475 (256 bp)   AC_000068.1 30009655 .. 30009910 (256 bp)   NW_001839003.1 23684741 .. 23684996 (256 bp)     Genomic (1) AC004912.2 115690 .. 115945 (256 bp)     ESTs (5 of 90)[Show All Hits] T03756.1 106 .. 361 (256 bp)   H42999.1 92 .. 347 (256 bp)   N24779.1 106 .. 361 (256 bp)   N33415.1 106 .. 363 (258 bp)   N64808.1 106 .. 362 (257 bp)     Whole Genome Shotgun sequences (5 of 6)[Show All Hits] AADD01079720.1 34690 .. 34945 (256 bp)   AADC01067024.1 131385 .. 131640 (256 bp)   AACC02000087.1 2744494 .. 2744749 (256 bp)   AADB02010433.1 2154870 .. 2155125 (256 bp)   ABBA01056806.1 35912 .. 36167 (256 bp)     Patent sequences (4) BD186742.1 84 .. 339 (256 bp)   CS351463.1 4843 .. 5098 (256 bp)   CS609649.1 84 .. 339 (256 bp)   DM165976.1 4852 .. 5107 (256 bp)        Macaca mulatta Name: D7S2271E Polymorphism info:   Cross References Gene GeneID: 696370   Symbol: SCRN1   Description: secernin 1   Position:   UniGene Mmu.14591 Secernin 1 Mapping Information D7S2271E Sequence Map: Chr 3 Map Viewer   Position: 96285198-96285468 (bp) Electronic PCR results RefSeq mRNA (3) XM_001086756.1 4742 .. 5012 (271 bp)   XM_001086879.1 5139 .. 5409 (271 bp)   XM_001086984.1 4842 .. 5112 (271 bp)     Genomic RefSeqs (1) NW_001114275.1 223859 .. 224129 (271 bp)     Whole Genome Shotgun sequences (1) AANU01125620.1 5839 .. 6109 (271 bp)        Pan troglodytes Name: D7S2271E Polymorphism info:   Cross References Gene GeneID: 463323   Symbol: SCRN1   Description: secernin 1   Position:   Mapping Information D7S2271E Sequence Map: Chr 7 Map Viewer   Position: 30287352-30287608 (bp) Electronic PCR results RefSeq mRNA (1) XM_519021.2 4850 .. 5106 (257 bp)     Genomic RefSeqs (1) NW_001237933.1 23402166 .. 23402422 (257 bp)     Genomic (1) AC187736.3 167860 .. 168116 (257 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC146158.1 157800 .. 158056 (257 bp)     Working Draft phase 2 (from GenBank HTGS division) (2) AC091622.2 37094 .. 37350 (257 bp)   AC094110.2 116117 .. 116373 (257 bp)     Whole Genome Shotgun sequences (2) AADA01257094.1 4277 .. 4533 (257 bp)   AACZ02082051.1 71665 .. 71921 (257 bp)        Papio anubis   Polymorphism info:   Electronic PCR results Genomic (2) AC091713.4 211751 .. 212019 (269 bp)   AC097004.3 78619 .. 78888 (270 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01275414.1 15849 .. 16106 (258 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement