ncbi logo		 UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:58050 Links
SHGC-76122
Homo sapiens chromosome 1, locus CAMSAP1L1
Macaca mulatta chromosome 1, locus LOC709092
Pan troglodytes chromosome 1, locus CAMSAP1L1

Found by e-PCR in sequences from Homo sapiens, Macaca mulatta, Oryctolagus cuniculus, Pan troglodytes, Papio anubis and Pongo abelii.

Primer InformationHelp

Forward primer:GTGCCATGCTTTTATTCAAATG
Reverse primer:TTTTTGTTTTTTAAGATGCTGTGC
PCR product size:100 (bp), Homo sapiens
GenBank Accession:G22458 R27809

   Homo sapiens
Name: SHGC-76122
Also known as: EST197854 WI-11811 stSG13939
Polymorphism info:  

Cross References Help
Gene GeneID:23271
 Symbol:CAMSAP1L1
 Description:calmodulin regulated spectrin-associated protein 1-like 1
 Position:1q32.1
UniGeneHs.23585 Calmodulin regulated spectrin-associated protein 1-like 1
 Hs.707507 Transcribed locus

Mapping InformationHelp
SHGC-76122 Sequence Map: Chr 1|HuRef Map Viewer
  Position: 171996860-171996959 (bp)
 
SHGC-76122 Sequence Map: Chr 1|Celera Map Viewer
  Position: 173953800-173953899 (bp)
 
SHGC-76122 Sequence Map: Chr 1 Map Viewer
  Position: 200829729-200829828 (bp)
 
WI-11811 NCBI RH Map: Chr 1 Map Viewer
  Position: 1670.6 (cR)
  Lod score: 3.35
 
WI-11811 Whitehead-RH Map: Chr 1 Map Viewer
  Position: 823.3 (cR3000)
  Lod score: P0.01
 
stSG13939 GeneMap99-GB4 Map: Chr 1 Map Viewer
  Position: 665.63 (cR3000)
  Lod score: 0.38
  Reference Interval: D1S2622-D1S306
 
WI-11811 GeneMap99-GB4 Map: Chr 1 Map Viewer
  Position: 665.63 (cR3000)
  Lod score: 0.38
  Reference Interval: D1S2622-D1S306

Electronic PCR results Help
RefSeq mRNA (1)
NM_203459.1 7249 .. 7348 (100 bp)  
 
mRNA (2)
AB029001.2 6640 .. 6739 (100 bp)  
BC045721.1 2356 .. 2455 (100 bp)  
 
Genomic RefSeqs (5 of 6)[Show All Hits]
NW_926128.1 39208559 .. 39208658 (100 bp)  
AC_000044.1 173953800 .. 173953899 (100 bp)  
AC_000133.1 171996860 .. 171996959 (100 bp)  
NW_001838533.2 5108292 .. 5108391 (100 bp)  
NT_004487.19 52318371 .. 52318470 (100 bp)  
 
Genomic (3)
G22458.1 2 .. 101 (100 bp)  
AL450104.14 151765 .. 151864 (100 bp)  
AC099756.2 42722 .. 42821 (100 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (2)
AC025349.2 164240 .. 164339 (100 bp)  
AC027113.3 119671 .. 119770 (100 bp)  
 
ESTs (5 of 40)[Show All Hits]
R23739.1 4 .. 103 (100 bp)  
R24528.1 6 .. 105 (100 bp)  
R27809.1 2 .. 101 (100 bp)  
H14341.1 12 .. 111 (100 bp)  
N50061.1 2 .. 101 (100 bp)  
 
Whole Genome Shotgun sequences (5)
AADD01011703.1 5845 .. 5944 (100 bp)  
AADC01009767.1 16372 .. 16471 (100 bp)  
AADB02001065.1 207853 .. 207952 (100 bp)  
ABBA01027542.1 21706 .. 21805 (100 bp)  
ABSL01055473.1 21704 .. 21803 (100 bp)  
 
Patent sequences (2)
BD250076.1 879 .. 978 (100 bp)  
BD457114.1 5125 .. 5224 (100 bp)  
 

   Macaca mulatta
Name: SHGC-76122
Polymorphism info:  

Cross References Help
Gene GeneID:709092
 Symbol:LOC709092
 Description:similar to calmodulin regulated spectrin-associated protein 1-like 1
 Position: 
UniGeneMmu.13923 Similar to calmodulin regulated spectrin-associated protein 1-like 1

Mapping InformationHelp
SHGC-76122 Sequence Map: Chr 1 Map Viewer
  Position: 169633147-169633246 (bp)

Electronic PCR results Help
RefSeq mRNA (1)
XM_001109492.1 7254 .. 7353 (100 bp)  
 
Genomic RefSeqs (1)
NW_001109048.1 3394425 .. 3394524 (100 bp)  
 
Whole Genome Shotgun sequences (1)
AANU01241850.1 19013 .. 19112 (100 bp)  
 

   Oryctolagus cuniculus
 
Polymorphism info:  

Electronic PCR results Help
ESTs (1)
EB380306.1 26 .. 125 (100 bp)  
 
Whole Genome Shotgun sequences (1)
AAGW02053997.1 6391 .. 6490 (100 bp)  
 

   Pan troglodytes
Name: SHGC-76122
Polymorphism info:  

Cross References Help
Gene GeneID:457611
 Symbol:CAMSAP1L1
 Description:calmodulin regulated spectrin-associated protein 1-like 1
 Position: 

Mapping InformationHelp
SHGC-76122 Sequence Map: Chr 1 Map Viewer
  Position: 180853307-180853406 (bp)

Electronic PCR results Help
RefSeq mRNA (5)
XM_001144062.1 7277 .. 7376 (100 bp)  
XM_514085.2 7244 .. 7343 (100 bp)  
XM_001143924.1 7196 .. 7295 (100 bp)  
XM_001143855.1 7253 .. 7352 (100 bp)  
XM_001143995.1 7043 .. 7142 (100 bp)  
 
Genomic RefSeqs (1)
NW_001229611.1 4015506 .. 4015605 (100 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01072568.1 498 .. 597 (100 bp)  
AACZ02012051.1 6084 .. 6183 (100 bp)  
 

   Papio anubis
 
Polymorphism info:  

Electronic PCR results Help
ESTs (2)
FC159573.1 649 .. 748 (100 bp)  
GE889532.1 650 .. 749 (100 bp)  
 

   Pongo abelii
 
Polymorphism info:  

Electronic PCR results Help
Whole Genome Shotgun sequences (1)
ABGA01386314.1 16253 .. 16352 (100 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement