PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:57638 Links RH64855 Homo sapiens chromosome 14, locus KIAA0831 Pan troglodytes chromosome 14, loci LOC744098 and FBXO34 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Pongo abelii. Primer Information Forward primer: GTGAACCTGATAACGTAATATC Reverse primer: GAAAGGTAGGAAGCAAGTA PCR product size: 201 (bp), Homo sapiens    Homo sapiens Name: RH64855 Also known as: stSG3489 Polymorphism info:   Cross References Gene GeneID: 22863   Symbol: KIAA0831   Description: KIAA0831   Position: 14q22.3 Mapping Information RH64855 Sequence Map: Chr 14|Celera Map Viewer   Position: 35897074-35897272 (bp)   RH64855 Sequence Map: Chr 14|HuRef Map Viewer   Position: 36010866-36011064 (bp)   RH64855 Sequence Map: Chr 14 Map Viewer   Position: 55847682-55847880 (bp)   stSG3489 GeneMap99-GB4 Map: Chr 14 Map Viewer   Position: 124.97 (cR3000)   Lod score: 0.00   Reference Interval: D14S281-D14S980 Electronic PCR results Genomic RefSeqs (5 of 6)[Show All Hits] NW_925561.1 2651604 .. 2651802 (199 bp)   AC_000057.1 35897074 .. 35897272 (199 bp)   NW_001838111.1 14711856 .. 14712054 (199 bp)   AC_000146.1 36010866 .. 36011064 (199 bp)   NT_026437.12 36847682 .. 36847880 (199 bp)     Genomic (2) G29508.1 70 .. 270 (201 bp)   AL356801.5 132342 .. 132540 (199 bp)     ESTs (5) T96658.1 52 .. 251 (200 bp)   H73005.1 70 .. 270 (201 bp)   W90067.1 72 .. 270 (199 bp)   AI248537.1 72 .. 270 (199 bp)   AI248544.1 72 .. 270 (199 bp)     Whole Genome Shotgun sequences (4) AADD01138324.1 2372 .. 2570 (199 bp)   AADB02016079.1 2651604 .. 2651802 (199 bp)   ABBA01018207.1 20862 .. 21060 (199 bp)   ABSL01047262.1 20862 .. 21060 (199 bp)        Pan troglodytes Name: RH64855 Polymorphism info:   Cross References Gene GeneID: 452922   Symbol: FBXO34   Description: F-box protein 34   Position:   Gene GeneID: 744098   Symbol: LOC744098   Description: similar to KIAA0831 protein   Position:   Mapping Information RH64855 Sequence Map: Chr 14 Map Viewer   Position: 54664794-54664992 (bp) Electronic PCR results Genomic RefSeqs (1) NW_001224602.1 21052701 .. 21052899 (199 bp)     Whole Genome Shotgun sequences (2) AADA01051555.1 4776 .. 4974 (199 bp)   AACZ02148843.1 1699 .. 1897 (199 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01012273.1 60848 .. 61046 (199 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement