PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:5657 Links WI-12390 Homo sapiens chromosome 5, locus C5orf33 Macaca mulatta locus C6H5orf33 Found by e-PCR in sequences from Homo sapiens, Macaca mulatta and Pongo abelii. Primer Information Forward primer: AATCAATAGTCATAACATCATCGTG Reverse primer: AAAATTTTCAAGACAGAGAATTTTG PCR product size: 125 (bp), Homo sapiens GenBank Accession: G13292 R60949    Homo sapiens Name: WI-12390 Also known as: EST237704 Polymorphism info:   Cross References Gene GeneID: 133686   Symbol: C5orf33   Description: chromosome 5 open reading frame 33   Position: 5p13.2 UniGene Hs.81907 Chromosome 5 open reading frame 33 Mapping Information WI-12390 Sequence Map: Chr 5|Celera Map Viewer   Position: 36080359-36080483 (bp)   WI-12390 Sequence Map: Chr 5|HuRef Map Viewer   Position: 36145672-36145796 (bp)   WI-12390 Sequence Map: Chr 5 Map Viewer   Position: 36194680-36194804 (bp)   WI-12390 NCBI RH Map: Chr 5 Map Viewer   Position: 175.4 (cR)   Lod score: 1.04   WI-12390 Whitehead-RH Map: Chr 5 Map Viewer   Position: 126.9 (cR3000)   Lod score: P0.71 Electronic PCR results RefSeq mRNA (2) NM_001085411.1 1771 .. 1895 (125 bp)   NM_153013.3 1532 .. 1656 (125 bp)     mRNA (4) AK055158.1 1504 .. 1628 (125 bp)   AK057950.1 886 .. 1010 (125 bp)   BX648388.1 1500 .. 1624 (125 bp)   BC062567.1 1518 .. 1642 (125 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_922596.1 1790873 .. 1790997 (125 bp)   AC_000048.1 36080359 .. 36080483 (125 bp)   NW_001838933.1 488283 .. 488407 (125 bp)   AC_000137.1 36145672 .. 36145796 (125 bp)   NT_006576.16 36184680 .. 36184804 (125 bp)     Genomic (3) G13292.1 46 .. 170 (125 bp)   AC008807.10 94344 .. 94468 (125 bp)   AC008942.6 36810 .. 36934 (125 bp)     ESTs (5 of 16)[Show All Hits] R60949.1 46 .. 170 (125 bp)   AA688425.1 42 .. 166 (125 bp)   AI816919.1 351 .. 475 (125 bp)   AI962601.1 377 .. 501 (125 bp)   AW975470.1 32 .. 156 (125 bp)     Whole Genome Shotgun sequences (5) AADD01057316.1 15043 .. 15167 (125 bp)   AADC01050217.1 4756 .. 4880 (125 bp)   AADB02008662.1 337353 .. 337477 (125 bp)   ABBA01024164.1 16095 .. 16219 (125 bp)   ABSL01051895.1 16096 .. 16220 (125 bp)     Patent sequences (2) AX713573.1 1504 .. 1628 (125 bp)   BD285796.1 1504 .. 1628 (125 bp)     High Thoughput cDNA sequences (1) BC045565.1 1659 .. 1783 (125 bp)        Macaca mulatta   Polymorphism info:   Cross References Gene GeneID: 704285   Symbol: C6H5orf33   Description: chromosome 5 open reading frame 33 ortholog   Position:   UniGene Mmu.13388 Similar to Y17G7B.10b Electronic PCR results RefSeq mRNA (1) XM_001092624.1 1838 .. 1964 (127 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01135482.1 2040 .. 2166 (127 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement