ncbi logo
UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:56197 Links
A004F48
Homo sapiens chromosome 6, locus VTA1
Pan troglodytes chromosome 6, locus VTA1

Found by e-PCR in sequences from Homo sapiens, Pan troglodytes, Papio anubis and Pongo abelii.

Primer InformationHelp

Forward primer:GTACACAGTAAGTTCATAATTCC
Reverse primer:CTTTAAATTAAGGTACTCCTCTG
PCR product size:138 (bp), Homo sapiens

   Homo sapiens
Name: A004F48
Also known as:
Polymorphism info:  

Cross References Help
Gene GeneID:51534
 Symbol:VTA1
 Description:Vps20-associated 1 homolog (S. cerevisiae)
 Position:6q24.1
UniGeneHs.431367 Vps20-associated 1 homolog (S. cerevisiae)
 Hs.603025 Transcribed locus

Mapping InformationHelp
A004F48 Sequence Map: Chr 6|HuRef Map Viewer
  Position: 140106557-140106695 (bp)
 
A004F48 Sequence Map: Chr 6 Map Viewer
  Position: 142540542-142540680 (bp)
 
A004F48 Sequence Map: Chr 6|Celera Map Viewer
  Position: 143281021-143281159 (bp)
 
A004F48 GeneMap99-GB4 Map: Chr 6 Map Viewer
  Position: 570.25 (cR3000)
  Lod score: 3.00
  Reference Interval: D6S453-D6S311

Electronic PCR results Help
RefSeq mRNA (1)
NM_016485.3 1701 .. 1839 (139 bp)  
 
mRNA (5 of 9)[Show All Hits]
AK000051.1 1702 .. 1840 (139 bp)  
AF271994.1 1701 .. 1839 (139 bp)  
AY007093.1 1516 .. 1654 (139 bp)  
AF060225.1 1704 .. 1842 (139 bp)  
BC005937.1 1607 .. 1745 (139 bp)  
 
Genomic RefSeqs (5 of 6)[Show All Hits]
NW_923184.1 75349625 .. 75349763 (139 bp)  
AC_000049.1 143281021 .. 143281159 (139 bp)  
AC_000138.1 140106557 .. 140106695 (139 bp)  
NW_001838990.2 15016203 .. 15016341 (139 bp)  
NT_025741.15 46709999 .. 46710137 (139 bp)  
 
Genomic (1)
AL033522.1 110219 .. 110357 (139 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (2)
AL355489.6 104504 .. 104642 (139 bp)  
AC090439.8 25604 .. 25742 (139 bp)  
 
ESTs (5 of 88)[Show All Hits]
R26554.1 60 .. 197 (138 bp)  
R49710.1 86 .. 223 (138 bp)  
R44499.1 69 .. 207 (139 bp)  
H19335.1 69 .. 206 (138 bp)  
R92341.1 60 .. 197 (138 bp)  
 
Whole Genome Shotgun sequences (5 of 6)[Show All Hits]
AADD01075698.1 1823 .. 1961 (139 bp)  
AADC01064570.1 110950 .. 111088 (139 bp)  
AADB02307843.1 330 .. 468 (139 bp)  
AADB02010193.1 1930283 .. 1930421 (139 bp)  
ABBA01025757.1 585521 .. 585659 (139 bp)  
 
Patent sequences (5 of 6)[Show All Hits]
AX330988.1 59 .. 197 (139 bp)  
CQ671636.1 103 .. 241 (139 bp)  
DD388104.1 1425 .. 1563 (139 bp)  
DL062384.1 59 .. 197 (139 bp)  
GN392547.1 103 .. 241 (139 bp)  
 
High Thoughput cDNA sequences (3)
AF151062.1 1708 .. 1846 (139 bp)  
AL136684.1 1705 .. 1843 (139 bp)  
BC013217.1 1205 .. 1343 (139 bp)  
 

   Pan troglodytes
Name: A004F48
Polymorphism info:  

Cross References Help
Gene GeneID:463033
 Symbol:VTA1
 Description:Vps20-associated 1 homolog (S. cerevisiae)
 Position: 

Mapping InformationHelp
A004F48 Sequence Map: Chr 6 Map Viewer
  Position: 144695583-144695721 (bp)

Electronic PCR results Help
RefSeq mRNA (3)
XM_518771.2 1892 .. 2030 (139 bp)  
XM_001172031.1 1895 .. 2033 (139 bp)  
XM_001172055.1 1811 .. 1949 (139 bp)  
 
Genomic RefSeqs (1)
NW_001236564.1 36903202 .. 36903340 (139 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01069970.1 4302 .. 4440 (139 bp)  
AACZ02076274.1 5488 .. 5626 (139 bp)  
 

   Papio anubis
 
Polymorphism info:  

Electronic PCR results Help
ESTs (5 of 17)[Show All Hits]
FC123344.1 16 .. 154 (139 bp)  
FC126213.1 21 .. 159 (139 bp)  
FC127358.1 16 .. 154 (139 bp)  
FC132249.1 294 .. 432 (139 bp)  
FC137251.1 21 .. 159 (139 bp)  
 

   Pongo abelii
 
Polymorphism info:  

Electronic PCR results Help
RefSeq mRNA (1)
NM_001133194.1 1731 .. 1869 (139 bp)  
 
Whole Genome Shotgun sequences (1)
ABGA01221140.1 5118 .. 5256 (139 bp)  
 
High Thoughput cDNA sequences (1)
CR860737.1 1731 .. 1869 (139 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement