PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:54723 Links D11S2311E Homo sapiens chromosome 11, locus KIAA0652 Pan troglodytes chromosome 11, locus KIAA0652 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GGGTGGGAGTGGTTTTGG Reverse primer: CAGGAGGAAGAAGGAAGGAG PCR product size: 161 (bp), Homo sapiens    Homo sapiens Name: D11S2311E Also known as: GDB:445917 Polymorphism info:   Cross References Gene GeneID: 9776   Symbol: KIAA0652   Description: KIAA0652   Position: 11p11.2 UniGene Hs.410092 Harbinger transposase derived 1 Mapping Information D11S2311E Sequence Map: Chr 11|HuRef Map Viewer   Position: 46400380-46400540 (bp)   D11S2311E Sequence Map: Chr 11 Map Viewer   Position: 46694340-46694500 (bp)   D11S2311E Sequence Map: Chr 11|Celera Map Viewer   Position: 46842554-46842714 (bp)   D11S2311E NCBI RH Map: Chr 11 Map Viewer   Position: 285 (cR)   Lod score: 1.28   D11S2311E GeneMap99-GB4 Map: Chr 11 Map Viewer   Position: 167.08 (cR3000)   Lod score: 2.49   Reference Interval: D11S1361-D11S1357 Electronic PCR results RefSeq mRNA (2) NM_014741.3 2583 .. 2743 (161 bp)   NM_001142673.1 2694 .. 2854 (161 bp)     mRNA (5 of 7)[Show All Hits] AB014552.1 2318 .. 2478 (161 bp)   AK000705.1 294 .. 453 (160 bp)   AK023867.1 2316 .. 2476 (161 bp)   BC001331.1 2012 .. 2172 (161 bp)   BC006191.2 1702 .. 1862 (161 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925006.1 42342878 .. 42343038 (161 bp)   AC_000054.1 46842554 .. 46842714 (161 bp)   AC_000143.1 46400380 .. 46400540 (161 bp)   NW_001838022.2 4215502 .. 4215662 (161 bp)   NT_009237.18 46634340 .. 46634500 (161 bp)     Genomic (1) AC115088.6 33312 .. 33472 (161 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC133587.1 138015 .. 138175 (161 bp)     Working Draft phase 2 (from GenBank HTGS division) (1) AC012054.3 78218 .. 78378 (161 bp)     ESTs (5 of 83)[Show All Hits] M62090.1 26 .. 186 (161 bp)   Z39810.1 85 .. 245 (161 bp)   R56549.1 94 .. 254 (161 bp)   H44753.1 85 .. 245 (161 bp)   H97223.1 85 .. 245 (161 bp)     Whole Genome Shotgun sequences (4) AADD01115159.1 11430 .. 11590 (161 bp)   AADB02013913.1 15846 .. 16006 (161 bp)   ABBA01060733.1 43700 .. 43860 (161 bp)   ABSL01073945.1 43700 .. 43860 (161 bp)     Patent sequences (5 of 7)[Show All Hits] BD155353.1 92 .. 252 (161 bp)   BD160253.1 2316 .. 2476 (161 bp)   AX875291.1 92 .. 252 (161 bp)   AX883319.1 2316 .. 2476 (161 bp)   CQ414250.1 2355 .. 2515 (161 bp)     Other sequences (3) NR_024587.1 2737 .. 2897 (161 bp)   NR_024588.1 2638 .. 2798 (161 bp)   NR_024589.1 2578 .. 2738 (161 bp)        Pan troglodytes Name: D11S2311E Polymorphism info:   Cross References Gene GeneID: 451155   Symbol: KIAA0652   Description: KIAA0652   Position:   Mapping Information D11S2311E Sequence Map: Chr 11 Map Viewer   Position: 47201899-47202059 (bp) Electronic PCR results RefSeq mRNA (1) NM_001098543.1 2265 .. 2425 (161 bp)     mRNA (1) AB222161.1 2265 .. 2425 (161 bp)     Genomic RefSeqs (1) NW_001222276.1 16769567 .. 16769727 (161 bp)     ESTs (1) DC529301.1 821 .. 981 (161 bp)     Whole Genome Shotgun sequences (2) AADA01228346.1 20364 .. 20524 (161 bp)   AACZ02124430.1 12072 .. 12232 (161 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement