PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:53102 Links SHGC-64038 Homo sapiens chromosome 7, locus C7orf20 Found by e-PCR in sequences from Homo sapiens, Macaca nemestrina, Pan troglodytes, Papio anubis and Pongo abelii. Primer Information Forward primer: GGCCTGTGCTTTATTGTGGG Reverse primer: CTGGAGGGACGTTTCAGAGG PCR product size: 214 (bp), Homo sapiens GenBank Accession: G38652    Homo sapiens Name: SHGC-64038 Polymorphism info:   Cross References Gene GeneID: 51608   Symbol: C7orf20   Description: chromosome 7 open reading frame 20   Position: 7p22.3 UniGene Hs.107387 Chromosome 7 open reading frame 20 Mapping Information SHGC-64038 Sequence Map: Chr 7|HuRef Map Viewer   Position: 853089-853307 (bp)   SHGC-64038 Sequence Map: Chr 7|Celera Map Viewer   Position: 903698-903916 (bp)   SHGC-64038 Sequence Map: Chr 7 Map Viewer   Position: 935099-935317 (bp)   SHGC-64038 Sequence Map: Chr 7|CRA_TCAGchr7v2 Map Viewer   Position: 989624-989842 (bp) Electronic PCR results RefSeq mRNA (1) NM_015949.2 1116 .. 1334 (219 bp)     mRNA (5 of 7)[Show All Hits] AF132954.1 1003 .. 1217 (215 bp)   AK023560.1 1040 .. 1258 (219 bp)   AK024305.1 1817 .. 2035 (219 bp)   BC003550.1 1058 .. 1276 (219 bp)   AK097899.1 2777 .. 2995 (219 bp)     Genomic RefSeqs (5 of 8)[Show All Hits] NW_923206.1 846095 .. 846313 (219 bp)   NT_079592.2 939624 .. 939842 (219 bp)   AC_000050.1 903698 .. 903916 (219 bp)   AC_000068.1 989624 .. 989842 (219 bp)   NW_001838998.1 655334 .. 655552 (219 bp)     Genomic (4) G38652.1 11 .. 224 (214 bp)   AC073957.7 16523 .. 16741 (219 bp)   BV176746.1 799 .. 1017 (219 bp)   BV178968.1 799 .. 1017 (219 bp)     ESTs (5 of 66)[Show All Hits] H57364.1 7 .. 225 (219 bp)   AA046210.1 13 .. 228 (216 bp)   AA127097.1 3 .. 220 (218 bp)   AA259124.1 11 .. 224 (214 bp)   AA432250.1 19 .. 240 (222 bp)     Whole Genome Shotgun sequences (5) AADD01077593.1 1857 .. 2075 (219 bp)   AACC02000129.1 230878 .. 231096 (219 bp)   AADB02010369.1 18264 .. 18482 (219 bp)   ABBA01039307.1 16826 .. 17044 (219 bp)   ABSL01062861.1 16828 .. 17046 (219 bp)     Patent sequences (5 of 12)[Show All Hits] BD120907.1 11 .. 230 (220 bp)   BD160026.1 1040 .. 1258 (219 bp)   BD160576.1 1817 .. 2035 (219 bp)   AX882951.1 1040 .. 1258 (219 bp)   AX883864.1 1817 .. 2035 (219 bp)     High Thoughput cDNA sequences (2) AL133014.1 1906 .. 2124 (219 bp)   CR612389.1 895 .. 1113 (219 bp)        Macaca nemestrina   Polymorphism info:   Electronic PCR results ESTs (2) EB521223.1 39 .. 255 (217 bp)   EB524213.1 47 .. 263 (217 bp)        Pan troglodytes   Polymorphism info:   Electronic PCR results Working Draft phase 1 (from GenBank HTGS division) (2) AC146112.2 20363 .. 20581 (219 bp)   AC213335.2 1963 .. 2181 (219 bp)        Papio anubis   Polymorphism info:   Electronic PCR results Working Draft phase 1 (from GenBank HTGS division) (2) AC148429.1 12584 .. 12800 (217 bp)   AC148512.1 22025 .. 22241 (217 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01217873.1 2495 .. 2712 (218 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement