PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:52060 Links WI-20523 Homo sapiens chromosome 17, locus PTRH2 Pan troglodytes chromosome 17, locus LOC455170 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Pongo abelii. Primer Information Forward primer: GGAGGGGTTGTTGTCATATCA Reverse primer: TCCAGCCCTACAAGCAGATT PCR product size: 300 (bp), Homo sapiens GenBank Accession: T65064    Homo sapiens Name: WI-20523 Also known as: HSA.13700 STS-T65064 Polymorphism info:   Cross References Gene GeneID: 51651   Symbol: PTRH2   Description: peptidyl-tRNA hydrolase 2   Position: 17q23.1 UniGene Hs.12677 Peptidyl-tRNA hydrolase 2 Mapping Information WI-20523 Sequence Map: Chr 17|HuRef Map Viewer   Position: 53147434-53147731 (bp)   WI-20523 Sequence Map: Chr 17|Celera Map Viewer   Position: 54238522-54238819 (bp)   WI-20523 Sequence Map: Chr 17 Map Viewer   Position: 57774771-57775068 (bp)   WI-20523 Whitehead-RH Map: Chr 17 Map Viewer   Position: 436.7 (cR3000)   Lod score: P1.62   WI-20523 GeneMap99-GB4 Map: Chr 17 Map Viewer   Position: 375.82 (cR3000)   Lod score: 1.51   Reference Interval: D17S791-D17S794 Electronic PCR results RefSeq mRNA (1) NM_016077.3 397 .. 694 (298 bp)     mRNA (5 of 6)[Show All Hits] AF151905.1 399 .. 696 (298 bp)   AL137322.1 265 .. 562 (298 bp)   BC006807.1 310 .. 607 (298 bp)   AK057033.1 1648 .. 1945 (298 bp)   AK098219.1 1786 .. 2083 (298 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_926894.1 12169544 .. 12169841 (298 bp)   AC_000060.1 54238522 .. 54238819 (298 bp)   NW_001838449.1 123215 .. 123512 (298 bp)   AC_000149.1 53147434 .. 53147731 (298 bp)   NT_010783.15 23048923 .. 23049220 (298 bp)     Genomic (2) AC091271.8 18780 .. 19077 (298 bp)   AC040904.4 55002 .. 55299 (298 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC074102.2 55314 .. 55611 (298 bp)     ESTs (5 of 56)[Show All Hits] T64979.1 105 .. 393 (289 bp)   T65064.1 111 .. 410 (300 bp)   N94348.1 110 .. 408 (299 bp)   W69273.1 103 .. 402 (300 bp)   AA122059.1 103 .. 400 (298 bp)     Whole Genome Shotgun sequences (5) AADD01155238.1 59882 .. 60179 (298 bp)   AADC01131271.1 4294 .. 4591 (298 bp)   AADB02018594.1 59870 .. 60167 (298 bp)   ABBA01003171.1 56939 .. 57236 (298 bp)   ABSL01067426.1 56939 .. 57236 (298 bp)     Patent sequences (5 of 7)[Show All Hits] BD063620.1 332 .. 629 (298 bp)   AX714588.1 1648 .. 1945 (298 bp)   CQ725311.1 397 .. 694 (298 bp)   CQ981331.1 399 .. 696 (298 bp)   BD286811.1 1648 .. 1945 (298 bp)     High Thoughput cDNA sequences (1) BC017457.1 1631 .. 1928 (298 bp)        Pan troglodytes Name: WI-20523 Polymorphism info:   Cross References Gene GeneID: 455170   Symbol: LOC455170   Description: hypothetical LOC455170   Position:   Mapping Information WI-20523 Sequence Map: Chr 17 Map Viewer   Position: 58900321-58900618 (bp) Electronic PCR results RefSeq mRNA (1) XR_022917.1 3723 .. 4020 (298 bp)     Genomic RefSeqs (1) NW_001226991.1 432972 .. 433269 (298 bp)     Whole Genome Shotgun sequences (2) AADA01066859.1 1698 .. 1995 (298 bp)   AACZ02172134.1 53409 .. 53706 (298 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01152269.1 19534 .. 19831 (298 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement