PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:5035 Links RH12902 Equus caballus chromosome 7, locus LOC100069130 Homo sapiens chromosome 11, locus DCUN1D5 Macaca mulatta chromosome 14, locus DCUN1D5 Pan troglodytes chromosome 11, locus DCUN1D5 Found by e-PCR in sequences from Equus caballus, Homo sapiens, Macaca mulatta, Pan troglodytes, Pongo abelii and Toxoplasma gondii. Primer Information Forward primer: AAGTCCGTCAGACATCATAGCA Reverse primer: ATGAATGAAAATGCACCCGT PCR product size: 120 (bp), Homo sapiens    Equus caballus Name: RH12902 Polymorphism info:   Cross References Gene GeneID: 100069130   Symbol: LOC100069130   Description: similar to DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)   Position:   Mapping Information RH12902 Sequence Map: Chr 7 Map Viewer   Position: 12910605-12910724 (bp) Electronic PCR results RefSeq mRNA (1) XM_001498937.2 973 .. 1092 (120 bp)     Genomic RefSeqs (1) NW_001867425.1 12910605 .. 12910724 (120 bp)     Whole Genome Shotgun sequences (1) AAWR02020662.1 244020 .. 244139 (120 bp)        Homo sapiens Name: RH12902 Also known as: GDB:214731 GDB:224169 stSG8199 Polymorphism info:   Cross References Gene GeneID: 84259   Symbol: DCUN1D5   Description: DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)   Position: 11q22.3 UniGene Hs.503716 DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae) Mapping Information RH12902 Sequence Map: Chr 11|Celera Map Viewer   Position: 100094522-100094641 (bp)   RH12902 Sequence Map: Chr 11 Map Viewer   Position: 102932988-102933107 (bp)   RH12902 Sequence Map: Chr 11|HuRef Map Viewer   Position: 98861703-98861822 (bp)   stSG8199 GeneMap99-GB4 Map: Chr 11 Map Viewer   Position: 352.42 (cR3000)   Lod score: 1.91   Reference Interval: D11S1339-D11S1343 Electronic PCR results RefSeq mRNA (1) NM_032299.2 963 .. 1082 (120 bp)     mRNA (3) AK056993.1 949 .. 1068 (120 bp)   BC004169.2 963 .. 1082 (120 bp)   AK298227.1 1103 .. 1222 (120 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925173.1 12963422 .. 12963541 (120 bp)   AC_000054.1 100094522 .. 100094641 (120 bp)   AC_000143.1 98861703 .. 98861822 (120 bp)   NW_001838042.2 17825187 .. 17825306 (120 bp)   NT_033899.8 6495404 .. 6495523 (120 bp)     Genomic (1) AP001486.5 110052 .. 110171 (120 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AP000875.2 159187 .. 159306 (120 bp)     ESTs (5 of 93)[Show All Hits] N79531.1 175 .. 294 (120 bp)   W16684.1 188 .. 307 (120 bp)   AA186873.1 156 .. 275 (120 bp)   D11592.1 68 .. 187 (120 bp)   D11608.1 68 .. 187 (120 bp)     Whole Genome Shotgun sequences (5) AADD01118862.1 35891 .. 36010 (120 bp)   AADC01101518.1 12365 .. 12484 (120 bp)   AADB02014337.1 3212582 .. 3212701 (120 bp)   ABBA01039928.1 132833 .. 132952 (120 bp)   ABSL01063281.1 132834 .. 132953 (120 bp)     Patent sequences (5 of 15)[Show All Hits] AX330536.1 188 .. 307 (120 bp)   E63728.1 1000 .. 1119 (120 bp)   BD095413.1 1000 .. 1119 (120 bp)   BD135291.1 351 .. 470 (120 bp)   AX714563.1 949 .. 1068 (120 bp)     High Thoughput cDNA sequences (5 of 12)[Show All Hits] BC021074.1 772 .. 891 (120 bp)   CR590369.1 925 .. 1044 (120 bp)   CR596583.1 990 .. 1109 (120 bp)   CR597372.1 962 .. 1081 (120 bp)   CR599845.1 981 .. 1100 (120 bp)        Macaca mulatta Name: RH12902 Polymorphism info:   Cross References Gene GeneID: 704099   Symbol: DCUN1D5   Description: DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)   Position:   UniGene Mmu.13426 Similar to CG6597-PA, isoform A Mapping Information RH12902 Sequence Map: Chr 14 Map Viewer   Position: 101671010-101671131 (bp) Electronic PCR results RefSeq mRNA (2) XM_001099205.1 821 .. 942 (122 bp)   XM_001099105.1 1092 .. 1213 (122 bp)     Genomic RefSeqs (1) NW_001100391.1 3827973 .. 3828094 (122 bp)     Whole Genome Shotgun sequences (1) AANU01120045.1 9036 .. 9157 (122 bp)        Pan troglodytes Name: RH12902 Polymorphism info:   Cross References Gene GeneID: 451514   Symbol: DCUN1D5   Description: DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)   Position:   Mapping Information RH12902 Sequence Map: Chr 11 Map Viewer   Position: 101716226-101716345 (bp) Electronic PCR results RefSeq mRNA (1) XM_508726.2 1058 .. 1177 (120 bp)     Genomic RefSeqs (1) NW_001222311.1 6584873 .. 6584992 (120 bp)     Whole Genome Shotgun sequences (2) AADA01065561.1 1154 .. 1273 (120 bp)   AACZ02127758.1 5228 .. 5347 (120 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results RefSeq mRNA (1) NM_001135498.1 982 .. 1100 (119 bp)     Whole Genome Shotgun sequences (1) ABGA01040260.1 10532 .. 10650 (119 bp)     High Thoughput cDNA sequences (1) CR857952.1 982 .. 1100 (119 bp)        Toxoplasma gondii   Polymorphism info:   Electronic PCR results ESTs (1) CB371862.1 179 .. 298 (120 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement