ncbi logo		 UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:47006 Links
D6S1192E
Homo sapiens chromosome 6, locus VTA1
Pan troglodytes chromosome 6, locus VTA1

Found by e-PCR in sequences from Homo sapiens, Pan troglodytes, Papio anubis and Pongo abelii.

Primer InformationHelp

Forward primer:GCACAAATGCAGGTAGTACAC
Reverse primer:GCTGCTGTAGAATGGATTTCAC
PCR product size:132 (bp), Homo sapiens

   Homo sapiens
Name: D6S1192E
Also known as: GDB:443460 stSG6393
Polymorphism info:  

Cross References Help
Gene GeneID:51534
 Symbol:VTA1
 Description:Vps20-associated 1 homolog (S. cerevisiae)
 Position:6q24.1
UniGeneHs.431367 Vps20-associated 1 homolog (S. cerevisiae)
 Hs.603025 Transcribed locus

Mapping InformationHelp
D6S1192E Sequence Map: Chr 6|HuRef Map Viewer
  Position: 140106579-140106710 (bp)
 
D6S1192E Sequence Map: Chr 6 Map Viewer
  Position: 142540564-142540695 (bp)
 
D6S1192E Sequence Map: Chr 6|Celera Map Viewer
  Position: 143281043-143281174 (bp)
 
stSG6393 GeneMap99-GB4 Map: Chr 6 Map Viewer
  Position: 570.25 (cR3000)
  Lod score: 3.00
  Reference Interval: D6S453-D6S311

Electronic PCR results Help
RefSeq mRNA (1)
NM_016485.3 1723 .. 1854 (132 bp)  
 
mRNA (5 of 9)[Show All Hits]
AK000051.1 1724 .. 1855 (132 bp)  
AF271994.1 1723 .. 1854 (132 bp)  
AY007093.1 1538 .. 1669 (132 bp)  
AF060225.1 1726 .. 1857 (132 bp)  
BC005937.1 1629 .. 1760 (132 bp)  
 
Genomic RefSeqs (5 of 6)[Show All Hits]
NW_923184.1 75349647 .. 75349778 (132 bp)  
AC_000049.1 143281043 .. 143281174 (132 bp)  
AC_000138.1 140106579 .. 140106710 (132 bp)  
NW_001838990.2 15016188 .. 15016319 (132 bp)  
NT_025741.15 46710021 .. 46710152 (132 bp)  
 
Genomic (1)
AL033522.1 110241 .. 110372 (132 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (2)
AL355489.6 104526 .. 104657 (132 bp)  
AC090439.8 25589 .. 25720 (132 bp)  
 
ESTs (5 of 84)[Show All Hits]
Z39509.1 50 .. 181 (132 bp)  
R26554.1 45 .. 176 (132 bp)  
R49710.1 71 .. 202 (132 bp)  
R44499.1 54 .. 185 (132 bp)  
H19335.1 54 .. 185 (132 bp)  
 
Whole Genome Shotgun sequences (5 of 6)[Show All Hits]
AADD01075698.1 1845 .. 1976 (132 bp)  
AADC01064570.1 110972 .. 111103 (132 bp)  
AADB02307843.1 352 .. 483 (132 bp)  
AADB02010193.1 1930268 .. 1930399 (132 bp)  
ABBA01025757.1 585506 .. 585637 (132 bp)  
 
Patent sequences (5 of 6)[Show All Hits]
AX330988.1 44 .. 175 (132 bp)  
CQ671636.1 125 .. 256 (132 bp)  
DD388104.1 1447 .. 1578 (132 bp)  
DL062384.1 44 .. 175 (132 bp)  
GN392547.1 125 .. 256 (132 bp)  
 
High Thoughput cDNA sequences (3)
AF151062.1 1730 .. 1861 (132 bp)  
AL136684.1 1727 .. 1858 (132 bp)  
BC013217.1 1227 .. 1358 (132 bp)  
 

   Pan troglodytes
Name: D6S1192E
Polymorphism info:  

Cross References Help
Gene GeneID:463033
 Symbol:VTA1
 Description:Vps20-associated 1 homolog (S. cerevisiae)
 Position: 

Mapping InformationHelp
D6S1192E Sequence Map: Chr 6 Map Viewer
  Position: 144695605-144695736 (bp)

Electronic PCR results Help
RefSeq mRNA (3)
XM_518771.2 1914 .. 2045 (132 bp)  
XM_001172031.1 1917 .. 2048 (132 bp)  
XM_001172055.1 1833 .. 1964 (132 bp)  
 
Genomic RefSeqs (1)
NW_001236564.1 36903224 .. 36903355 (132 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01069970.1 4287 .. 4418 (132 bp)  
AACZ02076274.1 5510 .. 5641 (132 bp)  
 

   Papio anubis
 
Polymorphism info:  

Electronic PCR results Help
ESTs (2)
GE898034.1 86 .. 217 (132 bp)  
GE899684.1 86 .. 217 (132 bp)  
 

   Pongo abelii
 
Polymorphism info:  

Electronic PCR results Help
RefSeq mRNA (1)
NM_001133194.1 1753 .. 1884 (132 bp)  
 
Whole Genome Shotgun sequences (1)
ABGA01221140.1 5103 .. 5234 (132 bp)  
 
High Thoughput cDNA sequences (1)
CR860737.1 1753 .. 1884 (132 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement