ncbi logo		 UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:46496 Links
RH16184
Homo sapiens chromosome 1, locus ADIPOR1
Macaca mulatta chromosome 1, locus LOC704626
Mus musculus chromosome 1, locus Adipor1
Pan troglodytes chromosome 1, locus ADIPOR1
Rattus norvegicus chromosome 13, locus Adipor1

Found by e-PCR in sequences from Felis catus, Homo sapiens, Macaca fascicularis, Macaca mulatta, Mus musculus, Pan troglodytes, Papio anubis, Pongo abelii, Rattus norvegicus, Spermophilus tridecemlineatus and Tupaia belangeri.

Primer InformationHelp

Forward primer:GATTTTCCATGTCCTGGTGG
Reverse primer:AGGCTCAGAGAAGGGTGTCA
PCR product size:120 (bp), Homo sapiens

   Felis catus
 
Polymorphism info:  

Electronic PCR results Help
Whole Genome Shotgun sequences (2)
AANG01029655.1 105 .. 223 (119 bp)  
ACBE01463653.1 247 .. 365 (119 bp)  
 

   Homo sapiens
Name: RH16184
Also known as: stSG8282
Polymorphism info:  

Cross References Help
Gene GeneID:51094
 Symbol:ADIPOR1
 Description:adiponectin receptor 1
 Position:1p36.13-q41
UniGeneHs.5298 Adiponectin receptor 1
 Hs.596200 Transcribed locus

Mapping InformationHelp
RH16184 Sequence Map: Chr 1|HuRef Map Viewer
  Position: 174076353-174076471 (bp)
 
RH16184 Sequence Map: Chr 1|Celera Map Viewer
  Position: 176039944-176040062 (bp)
 
RH16184 Sequence Map: Chr 1 Map Viewer
  Position: 202910697-202910815 (bp)
 
stSG8282 NCBI RH Map: Chr 1 Map Viewer
  Position: 1737.4 (cR)
  Lod score: 1.13
 
stSG8282 GeneMap99-GB4 Map: Chr 1 Map Viewer
  Position: 666.51 (cR3000)
  Lod score: 0.81
  Reference Interval: D1S2622-D1S306

Electronic PCR results Help
RefSeq mRNA (2)
NM_015999.3 1281 .. 1399 (119 bp)  
NM_001127687.1 1273 .. 1391 (119 bp)  
 
mRNA (5 of 9)[Show All Hits]
AF151803.1 1196 .. 1315 (120 bp)  
AK001484.1 1236 .. 1354 (119 bp)  
BC010743.1 1207 .. 1325 (119 bp)  
AK058114.1 1236 .. 1354 (119 bp)  
AF125179.1 1188 .. 1306 (119 bp)  
 
Genomic RefSeqs (5 of 6)[Show All Hits]
NW_926128.1 41294703 .. 41294821 (119 bp)  
AC_000044.1 176039944 .. 176040062 (119 bp)  
AC_000133.1 174076353 .. 174076471 (119 bp)  
NW_001838533.2 3028780 .. 3028898 (119 bp)  
NT_004487.19 54399339 .. 54399457 (119 bp)  
 
Genomic (4)
G25016.1 60 .. 179 (120 bp)  
G28365.1 60 .. 179 (120 bp)  
AC096632.3 50723 .. 50841 (119 bp)  
BV178066.1 737 .. 855 (119 bp)  
 
ESTs (5 of 136)[Show All Hits]
R62584.1 63 .. 179 (117 bp)  
H48233.1 60 .. 179 (120 bp)  
H53574.1 65 .. 182 (118 bp)  
H67771.1 24 .. 142 (119 bp)  
W95063.1 61 .. 178 (118 bp)  
 
Whole Genome Shotgun sequences (5)
AADD01011842.1 14936 .. 15054 (119 bp)  
AADC01009847.1 209 .. 327 (119 bp)  
AADB02001081.1 534218 .. 534336 (119 bp)  
ABBA01027490.1 7407 .. 7525 (119 bp)  
ABSL01055441.1 7407 .. 7525 (119 bp)  
 
Patent sequences (5 of 8)[Show All Hits]
AX083500.1 1262 .. 1380 (119 bp)  
BD156346.1 1236 .. 1354 (119 bp)  
BD205645.1 708 .. 826 (119 bp)  
AX876843.1 1236 .. 1354 (119 bp)  
CS063694.1 1207 .. 1325 (119 bp)  
 
High Thoughput cDNA sequences (5 of 13)[Show All Hits]
CR590124.1 1214 .. 1332 (119 bp)  
CR593948.1 1202 .. 1320 (119 bp)  
CR596346.1 1281 .. 1399 (119 bp)  
CR596678.1 1214 .. 1332 (119 bp)  
CR597679.1 1259 .. 1377 (119 bp)  
 

   Macaca fascicularis
 
Polymorphism info:  

Cross References Help
UniGeneMfa.3870 Brain cDNA clone: QtrA-15830, similar to human adiponectin receptor 1 (ADIPO...


Electronic PCR results Help
mRNA (1)
AB174286.1 686 .. 804 (119 bp)  
 
ESTs (2)
CJ442363.1 98 .. 216 (119 bp)  
DC639763.1 99 .. 217 (119 bp)  
 

   Macaca mulatta
Name: RH16184
Polymorphism info:  

Cross References Help
Gene GeneID:704626
 Symbol:LOC704626
 Description:similar to adiponectin receptor 1
 Position: 
UniGeneMmu.1334 Similar to adiponectin receptor 1

Mapping InformationHelp
RH16184 Sequence Map: Chr 1 Map Viewer
  Position: 167552711-167552829 (bp)

Electronic PCR results Help
RefSeq mRNA (5 of 6)[Show All Hits]
XM_001105680.1 1141 .. 1259 (119 bp)  
XM_001105751.1 1633 .. 1751 (119 bp)  
XM_001105805.1 1284 .. 1402 (119 bp)  
XM_001105878.1 1280 .. 1398 (119 bp)  
XM_001105957.1 1324 .. 1442 (119 bp)  
 
Genomic RefSeqs (1)
NW_001109048.1 1313989 .. 1314107 (119 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (1)
AC197505.3 45087 .. 45205 (119 bp)  
 
Whole Genome Shotgun sequences (1)
AANU01242012.1 34313 .. 34431 (119 bp)  
 

   Mus musculus
Name: RH16184
Polymorphism info:  

Cross References Help
Gene GeneID:72674
 Symbol:Adipor1
 Description:adiponectin receptor 1
 Position:1 E4
UniGeneMm.259976 Adiponectin receptor 1

Mapping InformationHelp
RH16184 Sequence Map: Chr 1 Map Viewer
  Position: 136328121-136328240 (bp)
 
RH16184 Sequence Map: Chr 1|Celera Map Viewer
  Position: 137038508-137038627 (bp)

Electronic PCR results Help
RefSeq mRNA (1)
NM_028320.3 1227 .. 1346 (120 bp)  
 
mRNA (2)
BC014875.1 1214 .. 1333 (120 bp)  
AY424290.1 1214 .. 1333 (120 bp)  
 
Genomic RefSeqs (2)
NW_001030662.1 48459934 .. 48460053 (120 bp)  
NT_078297.6 48984443 .. 48984562 (120 bp)  
 
Genomic (1)
AC131592.10 103299 .. 103418 (120 bp)  
 
ESTs (5 of 52)[Show All Hits]
W85463.1 8 .. 127 (120 bp)  
W81786.1 26 .. 145 (120 bp)  
AA107521.1 273 .. 392 (120 bp)  
AA200438.1 264 .. 384 (121 bp)  
AA463099.1 60 .. 179 (120 bp)  
 
Patent sequences (1)
DL240431.1 18065 .. 18184 (120 bp)  
 
High Thoughput cDNA sequences (5 of 6)[Show All Hits]
AK143679.1 1643 .. 1762 (120 bp)  
AK143680.1 1338 .. 1457 (120 bp)  
AK148140.1 1212 .. 1331 (120 bp)  
AK151565.1 1225 .. 1344 (120 bp)  
AK167896.1 1203 .. 1322 (120 bp)  
 

   Pan troglodytes
Name: RH16184
Polymorphism info:  

Cross References Help
Gene GeneID:457635
 Symbol:ADIPOR1
 Description:adiponectin receptor 1
 Position: 

Mapping InformationHelp
RH16184 Sequence Map: Chr 1 Map Viewer
  Position: 183000132-183000250 (bp)

Electronic PCR results Help
RefSeq mRNA (5 of 7)[Show All Hits]
XM_001152270.1 1197 .. 1315 (119 bp)  
XM_001152338.1 1633 .. 1751 (119 bp)  
XM_001152393.1 1251 .. 1369 (119 bp)  
XM_001152460.1 1273 .. 1391 (119 bp)  
XM_001152528.1 1276 .. 1394 (119 bp)  
 
Genomic RefSeqs (1)
NW_001229611.1 6162331 .. 6162449 (119 bp)  
 
Genomic (1)
BV598947.1 76 .. 194 (119 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01325655.1 2813 .. 2931 (119 bp)  
AACZ02012267.1 14308 .. 14426 (119 bp)  
 

   Papio anubis
 
Polymorphism info:  

Electronic PCR results Help
ESTs (5)
FC119600.1 294 .. 412 (119 bp)  
FC126798.1 712 .. 828 (117 bp)  
FC141867.1 366 .. 484 (119 bp)  
FC141945.1 457 .. 575 (119 bp)  
FC164290.1 363 .. 481 (119 bp)  
 

   Pongo abelii
 
Polymorphism info:  

Electronic PCR results Help
Whole Genome Shotgun sequences (1)
ABGA01056163.1 10271 .. 10389 (119 bp)  
 

   Rattus norvegicus
Name: RH16184
Polymorphism info:  

Cross References Help
Gene GeneID:289036
 Symbol:Adipor1
 Description:adiponectin receptor 1
 Position:13q13
UniGeneRn.104556 Adiponectin receptor 1

Mapping InformationHelp
RH16184 Sequence Map: Chr 13|Celera Map Viewer
  Position: 46206258-46206376 (bp)
 
RH16184 Sequence Map: Chr 13 Map Viewer
  Position: 47378768-47378886 (bp)

Electronic PCR results Help
RefSeq mRNA (1)
NM_207587.1 1231 .. 1349 (119 bp)  
 
mRNA (1)
BC061838.1 1231 .. 1349 (119 bp)  
 
Genomic RefSeqs (2)
NW_047395.1 2551191 .. 2551309 (119 bp)  
NW_001084685.1 7029201 .. 7029319 (119 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (2)
AC121398.4 242870 .. 242988 (119 bp)  
AC122649.4 61001 .. 61119 (119 bp)  
 
Working Draft phase 2 (from GenBank HTGS division) (1)
AC106215.7 191521 .. 191639 (119 bp)  
 
ESTs (5 of 14)[Show All Hits]
BG667970.1 77 .. 195 (119 bp)  
BQ205606.1 79 .. 197 (119 bp)  
BQ208259.1 87 .. 205 (119 bp)  
CV078586.1 531 .. 649 (119 bp)  
CV797409.1 87 .. 205 (119 bp)  
 
Whole Genome Shotgun sequences (2)
AAHX01075174.1 47588 .. 47706 (119 bp)  
AABR04021630.1 7265 .. 7383 (119 bp)  
 

   Spermophilus tridecemlineatus
 
Polymorphism info:  

Electronic PCR results Help
Whole Genome Shotgun sequences (4)
AAQQ01710996.1 907 .. 1025 (119 bp)  
AAQQ01684628.1 8797 .. 8915 (119 bp)  
AAQQ01502338.1 68 .. 186 (119 bp)  
AAQQ01139415.1 25916 .. 26034 (119 bp)  
 

   Tupaia belangeri
 
Polymorphism info:  

Electronic PCR results Help
Whole Genome Shotgun sequences (1)
AAPY01333363.1 1166 .. 1284 (119 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement