PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:45586 Links SGC32747 Homo sapiens chromosome 7, locus PUS7 Macaca mulatta locus PUS7 Mus musculus chromosome 13;5, loci Pus7, LOC100047009, and Gm2654 Pan troglodytes locus PUS7 Rattus norvegicus locus Pus7 Found by e-PCR in sequences from Felis catus, Homo sapiens, Macaca mulatta, Mus musculus, Pan troglodytes, Pongo abelii and Rattus norvegicus. Primer Information Forward primer: GATCCCAAAATTCCACTTTTC Reverse primer: CACTTCTCGAATGGCCATG PCR product size: 150 (bp), Homo sapiens GenBank Accession: D19605 G26163    Felis catus   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (2) AANG01394026.1 2220 .. 2913 (694 bp)   ACBE01068323.1 7405 .. 8098 (694 bp)        Homo sapiens Name: SGC32747 Also known as: EST47270 Polymorphism info:   Cross References Gene GeneID: 54517   Symbol: PUS7   Description: pseudouridylate synthase 7 homolog (S. cerevisiae)   Position: 7q22.3 UniGene Hs.520619 Pseudouridylate synthase 7 homolog (S. cerevisiae) Mapping Information SGC32747 Whitehead-RH Map: Chr 7 Map Viewer   Position: 481.0 (cR3000)   Lod score: P1.18   SGC32747 GeneMap99-GB4 Map: Chr 7 Map Viewer   Position: 521.91 (cR3000)   Lod score: 0.40   Reference Interval: D7S479-D7S2545 Electronic PCR results RefSeq mRNA (1) NM_019042.3 1996 .. 2145 (150 bp)     mRNA (5 of 6)[Show All Hits] AK000492.1 520 .. 669 (150 bp)   BC011396.1 1972 .. 2121 (150 bp)   AB067484.1 1730 .. 1879 (150 bp)   AK091283.1 1996 .. 2145 (150 bp)   BC005209.2 729 .. 878 (150 bp)     Genomic RefSeqs (5 of 8)[Show All Hits] NW_923640.1 2662580 .. 2663970 (1391 bp)   NT_079596.2 4494445 .. 4495835 (1391 bp)   AC_000050.1 99903829 .. 99905219 (1391 bp)   AC_000068.1 104458877 .. 104460267 (1391 bp)   AC_000139.1 99456427 .. 99457817 (1391 bp)     Genomic (3) G26163.1 1 .. 150 (150 bp)   AC073138.3 106112 .. 107502 (1391 bp)   DQ038210.1 1790 .. 1939 (150 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC073317.5 128060 .. 129450 (1391 bp)     ESTs (5 of 20)[Show All Hits] D19605.1 1 .. 150 (150 bp)   AA609161.1 201 .. 350 (150 bp)   AA806076.1 205 .. 354 (150 bp)   AW661948.1 196 .. 345 (150 bp)   BE463700.1 193 .. 342 (150 bp)     Whole Genome Shotgun sequences (5) AADD01084589.1 1779 .. 3169 (1391 bp)   AACC02000004.1 5968564 .. 5969954 (1391 bp)   AADB02010755.1 2075165 .. 2076555 (1391 bp)   ABBA01057948.1 45143 .. 46533 (1391 bp)   ABSL01072600.1 45141 .. 46531 (1391 bp)     Patent sequences (5 of 8)[Show All Hits] AX746894.1 1996 .. 2145 (150 bp)   CQ414516.1 1971 .. 2120 (150 bp)   CQ851388.1 1978 .. 2127 (150 bp)   CS084098.1 2178 .. 2327 (150 bp)   CS300587.1 1486 .. 1635 (150 bp)        Macaca mulatta   Polymorphism info:   Cross References Gene GeneID: 697463   Symbol: PUS7   Description: pseudouridylate synthase 7 homolog   Position:   UniGene Mmu.14860 Pseudouridylate synthase 7 homolog Electronic PCR results RefSeq mRNA (3) XM_001089515.1 1995 .. 2144 (150 bp)   XM_001089755.1 1996 .. 2145 (150 bp)   XM_001089640.1 1992 .. 2141 (150 bp)     Genomic RefSeqs (1) NW_001114281.1 4123696 .. 4124789 (1094 bp)     Whole Genome Shotgun sequences (1) AANU01287165.1 20364 .. 21457 (1094 bp)        Mus musculus Name: SGC32747 Polymorphism info:   Cross References Gene GeneID: 100040190   Symbol: Gm2654   Description: predicted gene 2654   Position: 13 A5|13 Gene GeneID: 100047009   Symbol: LOC100047009   Description: hypothetical protein LOC100047009   Position:   Gene GeneID: 78697   Symbol: Pus7   Description: pseudouridylate synthase 7 homolog (S. cerevisiae)   Position: 5 A3 UniGene Mm.58660 Pseudouridylate synthase 7 homolog (S. cerevisiae) Mapping Information SGC32747 Sequence Map: Chr 5|Celera Map Viewer   Position: 20689538-20690054 (bp)   SGC32747 Sequence Map: Chr 5 Map Viewer   Position: 23247718-23248234 (bp)   SGC32747 Sequence Map: Chr 13 Map Viewer   Position: 50882903-50883048 (bp) Electronic PCR results RefSeq mRNA (1) NM_178403.4 1956 .. 2105 (150 bp)     mRNA (5) BC008544.1 1960 .. 2109 (150 bp)   AK173290.1 1946 .. 2095 (150 bp)   EI191908.1 120 .. 269 (150 bp)   BC138533.1 1848 .. 1997 (150 bp)   BC145316.1 1866 .. 2015 (150 bp)     Genomic RefSeqs (3) NW_001030784.1 7972497 .. 7973013 (517 bp)   NT_165760.2 8135052 .. 8135568 (517 bp)   NT_039580.7 11039967 .. 11040112 (146 bp)     Genomic (5) AC122194.4 129780 .. 129925 (146 bp)   AC117663.13 173934 .. 174450 (517 bp)   AC122313.4 130481 .. 130626 (146 bp)   AC091683.53 5245 .. 5390 (146 bp)   AC117614.14 165929 .. 166445 (517 bp)     ESTs (5 of 10)[Show All Hits] AA590307.1 101 .. 250 (150 bp)   BI156317.1 153 .. 301 (149 bp)   BI684972.1 390 .. 539 (150 bp)   BY404349.1 62 .. 212 (151 bp)   BY542656.1 50 .. 199 (150 bp)     Whole Genome Shotgun sequences (2) CAAA01054780.1 9866 .. 10382 (517 bp)   AAHY01042844.1 11902 .. 12418 (517 bp)     Other sequences (3) XR_033125.1 2183 .. 2332 (150 bp)   XR_031471.1 1824 .. 1969 (146 bp)   XR_031664.1 1640 .. 1785 (146 bp)     High Thoughput cDNA sequences (5) AK021205.1 360 .. 509 (150 bp)   BC010600.1 741 .. 890 (150 bp)   AK160849.1 1958 .. 2107 (150 bp)   AK145380.1 2357 .. 2506 (150 bp)   AK142271.1 1975 .. 2124 (150 bp)        Pan troglodytes   Polymorphism info:   Cross References Gene GeneID: 472481   Symbol: PUS7   Description: pseudouridylate synthase 7 homolog (S. cerevisiae)   Position:   Electronic PCR results RefSeq mRNA (1) XM_527856.2 1971 .. 2120 (150 bp)     Genomic RefSeqs (1) NW_001238090.1 2134924 .. 2136312 (1389 bp)     Genomic (2) DQ038211.1 1791 .. 1940 (150 bp)   AC188418.3 72081 .. 73469 (1389 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC145989.1 170218 .. 171606 (1389 bp)     Whole Genome Shotgun sequences (2) AADA01245308.1 1889 .. 3281 (1393 bp)   AACZ02086701.1 449 .. 1837 (1389 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01065977.1 4615 .. 6009 (1395 bp)        Rattus norvegicus   Polymorphism info:   Cross References Gene GeneID: 296751   Symbol: Pus7   Description: pseudouridylate synthase 7 homolog (S. cerevisiae)   Position: 4q11 UniGene Rn.211647 Pseudouridylate synthase 7 homolog (S. cerevisiae) Electronic PCR results RefSeq mRNA (2) XM_216060.4 1868 .. 2017 (150 bp)   XM_001061692.1 1868 .. 2017 (150 bp)     Genomic RefSeqs (2) NW_047687.1 1031773 .. 1032299 (527 bp)   NW_001084825.1 1030315 .. 1030841 (527 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC096076.6 172911 .. 173437 (527 bp)     Working Draft phase 2 (from GenBank HTGS division) (1) AC109744.4 6903 .. 7881 (979 bp)     ESTs (2) CA334025.1 327 .. 476 (150 bp)   CB582200.1 43 .. 192 (150 bp)     Whole Genome Shotgun sequences (2) AAHX01027547.1 43950 .. 44476 (527 bp)   AABR04059497.1 7885 .. 8411 (527 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement