PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:42974 Links WI-14003 Homo sapiens chromosome 15, locus AQR Pan troglodytes chromosome 15, locus AQR Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GACACACTCAGTGATCAAAACATG Reverse primer: ATATTTGTTAACTGATTTCGGTGTC PCR product size: 130 (bp), Homo sapiens GenBank Accession: G21673 H01222    Homo sapiens Name: WI-14003 Also known as: EST261102 Polymorphism info:   Cross References Gene GeneID: 9716   Symbol: AQR   Description: aquarius homolog (mouse)   Position: 15q14 UniGene Hs.510958 Aquarius homolog (mouse)   Hs.608739 Transcribed locus, moderately similar to NP_055506.1 aquarius [Homo sapiens] Mapping Information WI-14003 Sequence Map: Chr 15|Celera Map Viewer   Position: 11908101-11908230 (bp)   WI-14003 Sequence Map: Chr 15|HuRef Map Viewer   Position: 11994367-11994496 (bp)   WI-14003 Sequence Map: Chr 15 Map Viewer   Position: 35148746-35148875 (bp)   WI-14003 NCBI RH Map: Chr 15 Map Viewer   Position: 68.3 (cR)   Lod score: 3.77   WI-14003 Whitehead-RH Map: Chr 15 Map Viewer   Position: 52.4 (cR3000)   Lod score: P1.45   WI-14003 GeneMap99-GB4 Map: Chr 15 Map Viewer   Position: 86.52 (cR3000)   Lod score: 2.49   Reference Interval: D15S144-D15S118 Electronic PCR results RefSeq mRNA (1) NM_014691.2 4757 .. 4886 (130 bp)     mRNA (5 of 7)[Show All Hits] AK001173.1 512 .. 641 (130 bp)   BX647820.1 5401 .. 5530 (130 bp)   BX648611.1 3462 .. 3591 (130 bp)   AB011132.3 4685 .. 4814 (130 bp)   BC108262.1 1513 .. 1642 (130 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925840.1 2190870 .. 2190999 (130 bp)   AC_000058.1 11908101 .. 11908230 (130 bp)   AC_000147.1 11994367 .. 11994496 (130 bp)   NW_001838214.2 8724516 .. 8724645 (130 bp)   NT_010194.17 5939303 .. 5939432 (130 bp)     Genomic (2) G21673.1 8 .. 137 (130 bp)   AC018868.4 42935 .. 43064 (130 bp)     Working Draft phase 1 (from GenBank HTGS division) (3) AC069140.2 9673 .. 9802 (130 bp)   AC090783.2 4976 .. 5105 (130 bp)   AC091056.4 42884 .. 43013 (130 bp)     ESTs (5 of 40)[Show All Hits] R66466.1 55 .. 184 (130 bp)   H01222.1 8 .. 137 (130 bp)   W04499.1 52 .. 181 (130 bp)   AA746598.1 111 .. 240 (130 bp)   AI092231.1 35 .. 164 (130 bp)     Whole Genome Shotgun sequences (5 of 7)[Show All Hits] AADD01142190.1 1000 .. 1129 (130 bp)   AADC01119744.1 221813 .. 221942 (130 bp)   AADB02016381.1 279733 .. 279862 (130 bp)   ABBA01250925.1 87 .. 216 (130 bp)   ABBA01038517.1 726 .. 855 (130 bp)     Patent sequences (5 of 6)[Show All Hits] BD147218.1 512 .. 641 (130 bp)   BD155980.1 512 .. 641 (130 bp)   AX867156.1 512 .. 641 (130 bp)   AX876153.1 512 .. 641 (130 bp)   DD129440.1 4831 .. 4960 (130 bp)     High Thoughput cDNA sequences (3) BC027452.1 654 .. 783 (130 bp)   BC048315.1 910 .. 1039 (130 bp)   EF553519.1 4718 .. 4847 (130 bp)        Pan troglodytes Name: WI-14003 Polymorphism info:   Cross References Gene GeneID: 453308   Symbol: AQR   Description: aquarius homolog (mouse)   Position:   Mapping Information WI-14003 Sequence Map: Chr 15 Map Viewer   Position: 31714594-31714723 (bp) Electronic PCR results RefSeq mRNA (1) XM_510286.2 4945 .. 5074 (130 bp)     Genomic RefSeqs (1) NW_001225228.1 310168 .. 310297 (130 bp)     Whole Genome Shotgun sequences (2) AADA01112666.1 1100 .. 1229 (130 bp)   AACZ02153949.1 1369 .. 1498 (130 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement