UniSTS

UniSTS:40272	Links
SHGC-2678
Canis familiaris chromosome 32;5, locus DCUN1D5
Equus caballus chromosome 7, locus LOC100069130
Homo sapiens chromosome 11, locus DCUN1D5
Macaca mulatta chromosome 14, locus DCUN1D5
Pan troglodytes chromosome 11, locus DCUN1D5
Found by e-PCR in sequences from Canis lupus, Equus caballus, Homo sapiens, Macaca mulatta, Pan troglodytes, Pongo abelii, Toxoplasma gondii and Tupaia belangeri.

Primer Information

Forward primer:	`CTTCTTGATGAATTTGTTGAGTGGC`
Reverse primer:	`ATATGAATGAAAATGCACCCGTTGG`
PCR product size:	150 (bp), Homo sapiens

Canis familiaris

Name:	SHGC-2678
Polymorphism info:


Cross References

Gene	GeneID:	487862
	Symbol:	DCUN1D5
	Description:	DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)
	Position:


Mapping Information

SHGC-2678	Sequence Map:	Chr 5	Map Viewer
	Position:	31775530-31775674 (bp)

SHGC-2678	Sequence Map:	Chr 32	Map Viewer
	Position:	19009782-19009927 (bp)

Canis lupus


Polymorphism info:


Electronic PCR results

RefSeq mRNA (1)
XM_544984.2	721 .. 865 (145 bp)

Genomic RefSeqs (2)
NW_876312.1	28775530 .. 28775674 (145 bp)
NW_876297.1	16009782 .. 16009927 (146 bp)

Whole Genome Shotgun sequences (3)
AACN010441097.1	768 .. 912 (145 bp)
AAEX02027409.1	472560 .. 472705 (146 bp)
AAEX02006701.1	26725 .. 26869 (145 bp)

Equus caballus

Name:	SHGC-2678
Polymorphism info:


Cross References

Gene	GeneID:	100069130
	Symbol:	LOC100069130
	Description:	similar to DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)
	Position:


Mapping Information

SHGC-2678	Sequence Map:	Chr 7	Map Viewer
	Position:	12910603-12910752 (bp)


Electronic PCR results

RefSeq mRNA (1)
XM_001498937.2	945 .. 1094 (150 bp)

Genomic RefSeqs (1)
NW_001867425.1	12910603 .. 12910752 (150 bp)

Whole Genome Shotgun sequences (1)
AAWR02020662.1	244018 .. 244167 (150 bp)

Homo sapiens

Name:	SHGC-2678
Also known as:	GDB:214731 GDB:224169
Polymorphism info:


Cross References

Gene	GeneID:	84259
	Symbol:	DCUN1D5
	Description:	DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)
	Position:	11q22.3
UniGene	Hs.503716	DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)


Mapping Information

SHGC-2678	Sequence Map:	Chr 11\|Celera	Map Viewer
	Position:	100094520-100094669 (bp)

SHGC-2678	Sequence Map:	Chr 11	Map Viewer
	Position:	102932986-102933135 (bp)

SHGC-2678	Sequence Map:	Chr 11\|HuRef	Map Viewer
	Position:	98861701-98861850 (bp)

SHGC-2678	TNG Map:	Chr 11	Map Viewer
	Position:	47726 (cR50000)
	Lod score:	17.6
	Reference Interval:	126

SHGC-2678	GeneMap99-G3 Map:	Chr 11	Map Viewer
	Position:	4523 (cR10000)
	Lod score:	F
	Reference Interval:	D11S1339-D11S1343


Electronic PCR results

RefSeq mRNA (1)
NM_032299.2	935 .. 1084 (150 bp)

mRNA (3)
AK056993.1	921 .. 1070 (150 bp)
BC004169.2	935 .. 1084 (150 bp)
AK298227.1	1075 .. 1224 (150 bp)

Genomic RefSeqs (5 of 6)[Show All Hits]
NW_925173.1	12963420 .. 12963569 (150 bp)
AC_000054.1	100094520 .. 100094669 (150 bp)
AC_000143.1	98861701 .. 98861850 (150 bp)
NW_001838042.2	17825159 .. 17825308 (150 bp)
NT_033899.8	6495402 .. 6495551 (150 bp)

Genomic (1)
AP001486.5	110050 .. 110199 (150 bp)

Working Draft phase 1 (from GenBank HTGS division) (1)
AP000875.2	159159 .. 159308 (150 bp)

ESTs (5 of 93)[Show All Hits]
N79531.1	173 .. 322 (150 bp)
W16684.1	160 .. 309 (150 bp)
AA186873.1	154 .. 303 (150 bp)
D11592.1	40 .. 189 (150 bp)
D11608.1	40 .. 189 (150 bp)

Whole Genome Shotgun sequences (5)
AADD01118862.1	35889 .. 36038 (150 bp)
AADC01101518.1	12363 .. 12512 (150 bp)
AADB02014337.1	3212580 .. 3212729 (150 bp)
ABBA01039928.1	132805 .. 132954 (150 bp)
ABSL01063281.1	132806 .. 132955 (150 bp)

Patent sequences (5 of 15)[Show All Hits]
AX330536.1	160 .. 309 (150 bp)
E63728.1	972 .. 1121 (150 bp)
BD095413.1	972 .. 1121 (150 bp)
BD135291.1	323 .. 472 (150 bp)
AX714563.1	921 .. 1070 (150 bp)

High Thoughput cDNA sequences (5 of 12)[Show All Hits]
BC021074.1	744 .. 893 (150 bp)
CR590369.1	897 .. 1046 (150 bp)
CR596583.1	962 .. 1111 (150 bp)
CR597372.1	934 .. 1083 (150 bp)
CR599845.1	953 .. 1102 (150 bp)

Macaca mulatta

Name:	SHGC-2678
Polymorphism info:


Cross References

Gene	GeneID:	704099
	Symbol:	DCUN1D5
	Description:	DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)
	Position:
UniGene	Mmu.13426	Similar to CG6597-PA, isoform A


Mapping Information

SHGC-2678	Sequence Map:	Chr 14	Map Viewer
	Position:	101671008-101671159 (bp)


Electronic PCR results

RefSeq mRNA (2)
XM_001099205.1	793 .. 944 (152 bp)
XM_001099105.1	1064 .. 1215 (152 bp)

Genomic RefSeqs (1)
NW_001100391.1	3827971 .. 3828122 (152 bp)

Whole Genome Shotgun sequences (1)
AANU01120045.1	9008 .. 9159 (152 bp)

Pan troglodytes

Name:	SHGC-2678
Polymorphism info:


Cross References

Gene	GeneID:	451514
	Symbol:	DCUN1D5
	Description:	DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)
	Position:


Mapping Information

SHGC-2678	Sequence Map:	Chr 11	Map Viewer
	Position:	101716224-101716373 (bp)


Electronic PCR results

RefSeq mRNA (1)
XM_508726.2	1030 .. 1179 (150 bp)

Genomic RefSeqs (1)
NW_001222311.1	6584871 .. 6585020 (150 bp)

Whole Genome Shotgun sequences (2)
AADA01065561.1	1126 .. 1275 (150 bp)
AACZ02127758.1	5200 .. 5349 (150 bp)

Pongo abelii


Polymorphism info:


Electronic PCR results

RefSeq mRNA (1)
NM_001135498.1	954 .. 1102 (149 bp)

Whole Genome Shotgun sequences (1)
ABGA01040260.1	10504 .. 10652 (149 bp)

High Thoughput cDNA sequences (1)
CR857952.1	954 .. 1102 (149 bp)

Toxoplasma gondii


Polymorphism info:


Electronic PCR results

ESTs (1)
CB371862.1	177 .. 326 (150 bp)

Tupaia belangeri


Polymorphism info:


Electronic PCR results

Whole Genome Shotgun sequences (1)
AAPY01310455.1	1574 .. 1724 (151 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer Privacy statement