PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:38576 Links RH12753 Homo sapiens chromosome 11, locus TCP11L1 Macaca mulatta chromosome 14, locus LOC694899 Pan troglodytes chromosome 11, locus TCP11L1 Found by e-PCR in sequences from Homo sapiens, Macaca fascicularis, Macaca mulatta, Pan troglodytes and Pongo abelii. Primer Information Forward primer: CTGCTGCTGTAGGGTGCATA Reverse primer: GTTGCTATTAAATTTGCTCGCC PCR product size: 120 (bp), Homo sapiens    Homo sapiens Name: RH12753 Also known as: stSG4616 Polymorphism info:   Cross References Gene GeneID: 55346   Symbol: TCP11L1   Description: t-complex 11 (mouse)-like 1   Position: 11p13 UniGene Hs.655341 T-complex 11 (mouse)-like 1 Mapping Information RH12753 Sequence Map: Chr 11|HuRef Map Viewer   Position: 32788800-32788919 (bp)   RH12753 Sequence Map: Chr 11 Map Viewer   Position: 33094127-33094246 (bp)   RH12753 Sequence Map: Chr 11|Celera Map Viewer   Position: 33240827-33240946 (bp)   stSG4616 NCBI RH Map: Chr 11 Map Viewer   Position: 235.4 (cR)   Lod score: 1.71   stSG4616 GeneMap99-GB4 Map: Chr 11 Map Viewer   Position: 125.99 (cR3000)   Lod score: 1.09   Reference Interval: D11S914-D11S907 Electronic PCR results RefSeq mRNA (2) NM_001145541.1 1651 .. 1770 (120 bp)   NM_018393.3 1835 .. 1954 (120 bp)     mRNA (3) AK002198.1 1633 .. 1752 (120 bp)   AK090646.1 1818 .. 1937 (120 bp)   BC041696.1 1654 .. 1773 (120 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925006.1 28741151 .. 28741270 (120 bp)   AC_000054.1 33240827 .. 33240946 (120 bp)   AC_000143.1 32788800 .. 32788919 (120 bp)   NW_001838022.2 17827123 .. 17827242 (120 bp)   NT_009237.18 33034127 .. 33034246 (120 bp)     Genomic (2) AL121926.24 70273 .. 70392 (120 bp)   AC131263.6 135263 .. 135382 (120 bp)     Low-pass Sequence Sampling (from GenBank HTGS division) (2) AC087716.1 26103 .. 26222 (120 bp)   AC087716.1 32575 .. 32694 (120 bp)     ESTs (5 of 9)[Show All Hits] T27081.1 145 .. 264 (120 bp)   R51067.1 155 .. 274 (120 bp)   R41697.1 155 .. 278 (124 bp)   W81641.1 195 .. 314 (120 bp)   AA569320.1 201 .. 320 (120 bp)     Whole Genome Shotgun sequences (5) AADD01114363.1 783 .. 902 (120 bp)   AADC01097258.1 526496 .. 526615 (120 bp)   AADB02013801.1 575650 .. 575769 (120 bp)   ABBA01060898.1 146380 .. 146499 (120 bp)   ABSL01074064.1 146381 .. 146500 (120 bp)     Patent sequences (4) BD155073.1 149 .. 268 (120 bp)   BD157170.1 1633 .. 1752 (120 bp)   AX875011.1 149 .. 268 (120 bp)   AX878356.1 1633 .. 1752 (120 bp)     High Thoughput cDNA sequences (1) BC030582.1 3131 .. 3250 (120 bp)        Macaca fascicularis   Polymorphism info:   Cross References UniGene Mfa.12534 Brain cDNA clone: QflA-16145, similar to human hypothetical protein FLJ11336... Electronic PCR results mRNA (1) AB171974.1 1667 .. 1786 (120 bp)        Macaca mulatta Name: RH12753 Polymorphism info:   Cross References Gene GeneID: 694899   Symbol: LOC694899   Description: similar to CG16721-PA   Position:   Mapping Information RH12753 Sequence Map: Chr 14 Map Viewer   Position: 38745942-38746061 (bp) Electronic PCR results Genomic RefSeqs (1) NW_001100377.1 748874 .. 748993 (120 bp)     Whole Genome Shotgun sequences (1) AANU01216634.1 8011 .. 8130 (120 bp)        Pan troglodytes Name: RH12753 Polymorphism info:   Cross References Gene GeneID: 466483   Symbol: TCP11L1   Description: t-complex 11 (mouse)-like 1   Position:   Mapping Information RH12753 Sequence Map: Chr 11 Map Viewer   Position: 33308301-33308420 (bp) Electronic PCR results Genomic RefSeqs (1) NW_001222276.1 2875969 .. 2876088 (120 bp)     Whole Genome Shotgun sequences (2) AADA01359733.1 50613 .. 50732 (120 bp)   AACZ02123700.1 135042 .. 135161 (120 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01362631.1 6205 .. 6324 (120 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement