PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:37229 Links SHGC-34701 Homo sapiens chromosome 1, locus ADIPOR1 Pan troglodytes chromosome 1, locus ADIPOR1 Found by e-PCR in sequences from Homo sapiens, Macaca mulatta, Pan troglodytes and Pongo abelii. Primer Information Forward primer: CTCCTTGCATTATCCTAAAGGC Reverse primer: CGTAACGGAATTCCTGAAGG PCR product size: 135 (bp), Homo sapiens GenBank Accession: G25016 G28365 H48233    Homo sapiens Name: SHGC-34701 Also known as: EST349440 SGC34701 Polymorphism info:   Cross References Gene GeneID: 51094   Symbol: ADIPOR1   Description: adiponectin receptor 1   Position: 1p36.13-q41 UniGene Hs.5298 Adiponectin receptor 1   Hs.596200 Transcribed locus Mapping Information SHGC-34701 Sequence Map: Chr 1|HuRef Map Viewer   Position: 174076395-174076529 (bp)   SHGC-34701 Sequence Map: Chr 1|Celera Map Viewer   Position: 176039986-176040120 (bp)   SHGC-34701 Sequence Map: Chr 1 Map Viewer   Position: 202910739-202910873 (bp)   SHGC-34701 TNG Map: Chr 1 Map Viewer   Position: 99897 (cR50000)   Lod score: 11.9   Reference Interval: 249   SGC34701 Whitehead-RH Map: Chr 1 Map Viewer   Position: 826.9 (cR3000)   Lod score: P0.01   SGC34701 GeneMap99-GB4 Map: Chr 1 Map Viewer   Position: 670.74 (cR3000)   Lod score: 0.27   Reference Interval: D1S306-D1S491 Electronic PCR results Genomic RefSeqs (5 of 6)[Show All Hits] NW_926128.1 41294745 .. 41294879 (135 bp)   AC_000044.1 176039986 .. 176040120 (135 bp)   AC_000133.1 174076395 .. 174076529 (135 bp)   NW_001838533.2 3028722 .. 3028856 (135 bp)   NT_004487.19 54399381 .. 54399515 (135 bp)     Genomic (3) G25016.1 2 .. 136 (135 bp)   G28365.1 2 .. 136 (135 bp)   AC096632.3 50765 .. 50899 (135 bp)     ESTs (3) H48233.1 2 .. 136 (135 bp)   H53574.1 7 .. 141 (135 bp)   BM922736.1 676 .. 810 (135 bp)     Whole Genome Shotgun sequences (5) AADD01011842.1 14978 .. 15112 (135 bp)   AADC01009847.1 251 .. 385 (135 bp)   AADB02001081.1 534160 .. 534294 (135 bp)   ABBA01027490.1 7349 .. 7483 (135 bp)   ABSL01055441.1 7349 .. 7483 (135 bp)        Macaca mulatta   Polymorphism info:   Electronic PCR results Working Draft phase 1 (from GenBank HTGS division) (1) AC197505.3 45129 .. 45264 (136 bp)        Pan troglodytes Name: SHGC-34701 Polymorphism info:   Cross References Gene GeneID: 457635   Symbol: ADIPOR1   Description: adiponectin receptor 1   Position:   Mapping Information SHGC-34701 Sequence Map: Chr 1 Map Viewer   Position: 183000174-183000308 (bp) Electronic PCR results Genomic RefSeqs (1) NW_001229611.1 6162373 .. 6162507 (135 bp)     Genomic (1) BV598947.1 118 .. 252 (135 bp)     Whole Genome Shotgun sequences (2) AADA01325655.1 2755 .. 2889 (135 bp)   AACZ02012267.1 14250 .. 14384 (135 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01056163.1 10313 .. 10447 (135 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement