ncbi logo
UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:36412 Links
D12S1180E
Homo sapiens chromosome 12, locus C12orf44
Pan troglodytes chromosome 12, locus LOC451914

Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Pongo abelii.

Primer InformationHelp

Forward primer:CTCAACTTTATTCCCCATCCC
Reverse primer:CTGCCTCTACTGTCTCTCC
PCR product size:92 (bp), Homo sapiens

   Homo sapiens
Name: D12S1180E
Also known as: Cda0gh04 GDB:446136 GDB:449765
Polymorphism info:  

Cross References Help
Gene GeneID:60673
 Symbol:C12orf44
 Description:chromosome 12 open reading frame 44
 Position:12q13.13
UniGeneHs.9911 Chromosome 12 open reading frame 44

Mapping InformationHelp
D12S1180E Sequence Map: Chr 12|HuRef Map Viewer
  Position: 49504336-49504428 (bp)
 
D12S1180E Sequence Map: Chr 12|Celera Map Viewer
  Position: 51273843-51273935 (bp)
 
D12S1180E Sequence Map: Chr 12 Map Viewer
  Position: 52471169-52471261 (bp)
 
Cda0gh04 GeneMap99-GB4 Map: Chr 12 Map Viewer
  Position: 228.58 (cR3000)
  Lod score: 0.94
  Reference Interval: D12S333-D12S325

Electronic PCR results Help
RefSeq mRNA (2)
NM_021934.4 1327 .. 1419 (93 bp)  
NM_001098673.1 1156 .. 1248 (93 bp)  
 
mRNA (4)
AK021835.1 1325 .. 1417 (93 bp)  
AF218031.1 1267 .. 1359 (93 bp)  
BC005151.2 1279 .. 1371 (93 bp)  
BC009937.2 1261 .. 1353 (93 bp)  
 
Genomic RefSeqs (5 of 6)[Show All Hits]
NW_925351.1 14819749 .. 14819841 (93 bp)  
AC_000055.1 51273843 .. 51273935 (93 bp)  
NW_001838057.1 11936607 .. 11936699 (93 bp)  
AC_000144.1 49504336 .. 49504428 (93 bp)  
NT_029419.12 14614475 .. 14614567 (93 bp)  
 
Genomic (2)
G06241.1 7 .. 98 (92 bp)  
AC025259.49 6244 .. 6336 (93 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (2)
AC019244.3 137822 .. 137914 (93 bp)  
AC080174.2 21009 .. 21101 (93 bp)  
 
ESTs (5 of 71)[Show All Hits]
Z38585.1 7 .. 98 (92 bp)  
T55569.1 27 .. 119 (93 bp)  
N92368.1 8 .. 100 (93 bp)  
AA565586.1 7 .. 98 (92 bp)  
AA579904.1 7 .. 99 (93 bp)  
 
Whole Genome Shotgun sequences (5)
AADD01124073.1 4774 .. 4866 (93 bp)  
AADC01105985.1 109481 .. 109573 (93 bp)  
AADB02014966.1 45729 .. 45821 (93 bp)  
ABBA01031626.1 8373 .. 8465 (93 bp)  
ABSL01057691.1 8375 .. 8467 (93 bp)  
 
Patent sequences (5 of 8)[Show All Hits]
BD151515.1 7 .. 99 (93 bp)  
BD159175.1 1325 .. 1417 (93 bp)  
BD251806.1 1315 .. 1407 (93 bp)  
AX871453.1 7 .. 99 (93 bp)  
AX881639.1 1325 .. 1417 (93 bp)  
 

   Pan troglodytes
Name: D12S1180E
Polymorphism info:  

Cross References Help
Gene GeneID:451914
 Symbol:LOC451914
 Description:similar to Chromosome 12 open reading frame 44
 Position: 

Mapping InformationHelp
D12S1180E Sequence Map: Chr 12 Map Viewer
  Position: 37558494-37558586 (bp)

Electronic PCR results Help
RefSeq mRNA (5)
XM_001144385.1 1283 .. 1375 (93 bp)  
XM_509074.2 1087 .. 1179 (93 bp)  
XM_001144538.1 1127 .. 1219 (93 bp)  
XM_001144617.1 1436 .. 1528 (93 bp)  
XM_001144690.1 1330 .. 1422 (93 bp)  
 
Genomic RefSeqs (1)
NW_001223157.1 2117523 .. 2117615 (93 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01247469.1 1816 .. 1908 (93 bp)  
AACZ02133760.1 8688 .. 8780 (93 bp)  
 

   Pongo abelii
 
Polymorphism info:  

Electronic PCR results Help
Whole Genome Shotgun sequences (1)
ABGA01169048.1 16381 .. 16473 (93 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement