PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:34517 Links SHGC-76638 Primer Information Forward primer: CGATTGACAACCTTTTATTTTTC Reverse primer: AGTAGGAGGGAAATCTCACCTT PCR product size: 150 (bp), Homo sapiens GenBank Accession: G43246 T03696    Homo sapiens Name: SHGC-76638 Also known as: CL_EST22724 WI-18668 WIAF-1801 WIAF-1801-STS Polymorphism info:   Cross References Gene GeneID: 51097   Symbol: SCCPDH   Description: saccharopine dehydrogenase (putative)   Position: 1q44 UniGene Hs.498397 Saccharopine dehydrogenase (putative) Mapping Information SHGC-76638 Sequence Map: Chr 1|HuRef Map Viewer   Position: 217319573-217319722 (bp)   SHGC-76638 Sequence Map: Chr 1|Celera Map Viewer   Position: 220223229-220223378 (bp)   SHGC-76638 Sequence Map: Chr 1 Map Viewer   Position: 246930984-246931133 (bp)   SHGC-76638 TNG Map: Chr 1 Map Viewer   Position: 125205 (cR50000)   Lod score: 13.5   Reference Interval: 306   WI-18668 Whitehead-RH Map: Chr 1 Map Viewer   Position: 941.1 (cR3000)   Lod score: P1.27   WIAF-1801 GeneMap99-GB4 Map: Chr 1 Map Viewer   Position: 764.67 (cR3000)   Lod score: 3.00   Reference Interval: D1S423-qTEL Electronic PCR results RefSeq mRNA (1) NM_016002.2 2019 .. 2168 (150 bp)     mRNA (3) G43246.1 1 .. 150 (150 bp)   AF151807.1 1669 .. 1818 (150 bp)   BC026185.2 1680 .. 1829 (150 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_927572.1 3580343 .. 3580492 (150 bp)   AC_000044.1 220223229 .. 220223378 (150 bp)   NW_001838554.1 126230 .. 126379 (150 bp)   AC_000133.1 217319573 .. 217319722 (150 bp)   NT_167186.1 40448763 .. 40448912 (150 bp)     Genomic (1) AL591848.13 101704 .. 101853 (150 bp)     ESTs (5 of 52)[Show All Hits] T03696.1 1 .. 150 (150 bp)   T15857.1 1 .. 150 (150 bp)   F08852.1 1 .. 150 (150 bp)   H05615.1 25 .. 174 (150 bp)   H09766.1 25 .. 174 (150 bp)     Whole Genome Shotgun sequences (4) AADD01014544.1 891 .. 1040 (150 bp)   AADB02001337.1 74880 .. 75029 (150 bp)   ABBA01031768.1 42828 .. 42977 (150 bp)   ABSL01057774.1 42839 .. 42988 (150 bp)     Patent sequences (5 of 9)[Show All Hits] AX082299.1 1779 .. 1928 (150 bp)   AX408351.1 10 .. 159 (150 bp)   AX779918.1 2040 .. 2189 (150 bp)   BD458653.1 1711 .. 1860 (150 bp)   BD446576.1 1669 .. 1818 (150 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement