PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:33090 Links WI-18541 Homo sapiens chromosome 1, locus ADIPOR1 Found by e-PCR in sequences from Homo sapiens and Pongo abelii. Primer Information Forward primer: CCTCCTTGCATTATCCTAAAGG Reverse primer: GCCCCCTTCTAGGCCGTA PCR product size: 150 (bp), Homo sapiens GenBank Accession: H48233    Homo sapiens Name: WI-18541 Also known as: CL_EST349440 Polymorphism info:   Cross References Gene GeneID: 51094   Symbol: ADIPOR1   Description: adiponectin receptor 1   Position: 1p36.13-q41 UniGene Hs.5298 Adiponectin receptor 1   Hs.596200 Transcribed locus Mapping Information WI-18541 Sequence Map: Chr 1|HuRef Map Viewer   Position: 174076381-174076530 (bp)   WI-18541 Sequence Map: Chr 1|Celera Map Viewer   Position: 176039972-176040121 (bp)   WI-18541 Sequence Map: Chr 1 Map Viewer   Position: 202910725-202910874 (bp)   WI-18541 Whitehead-RH Map: Chr 1 Map Viewer   Position: 826.7 (cR3000)   Lod score: P1.48   WI-18541 GeneMap99-GB4 Map: Chr 1 Map Viewer   Position: 666.51 (cR3000)   Lod score: 0.81   Reference Interval: D1S2622-D1S306 Electronic PCR results Genomic RefSeqs (5 of 6)[Show All Hits] NW_926128.1 41294731 .. 41294880 (150 bp)   AC_000044.1 176039972 .. 176040121 (150 bp)   AC_000133.1 174076381 .. 174076530 (150 bp)   NW_001838533.2 3028721 .. 3028870 (150 bp)   NT_004487.19 54399367 .. 54399516 (150 bp)     Genomic (3) G25016.1 1 .. 150 (150 bp)   G28365.1 1 .. 150 (150 bp)   AC096632.3 50751 .. 50900 (150 bp)     ESTs (3) H48233.1 1 .. 150 (150 bp)   H53574.1 6 .. 155 (150 bp)   BM922736.1 675 .. 824 (150 bp)     Whole Genome Shotgun sequences (5) AADD01011842.1 14964 .. 15113 (150 bp)   AADC01009847.1 237 .. 386 (150 bp)   AADB02001081.1 534159 .. 534308 (150 bp)   ABBA01027490.1 7348 .. 7497 (150 bp)   ABSL01055441.1 7348 .. 7497 (150 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01056163.1 10299 .. 10448 (150 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement