PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:33061 Links RH66307 Primer Information Forward primer: CCTCCTACTGCGGCAAG Reverse primer: ATGAGCTGGCAGGTCTAATG PCR product size: 127 (bp), Homo sapiens    Homo sapiens Name: RH66307 Also known as: stSG35331 Polymorphism info:   Cross References Gene GeneID: 51097   Symbol: SCCPDH   Description: saccharopine dehydrogenase (putative)   Position: 1q44 UniGene Hs.498397 Saccharopine dehydrogenase (putative) Mapping Information RH66307 Sequence Map: Chr 1|HuRef Map Viewer   Position: 217319455-217319581 (bp)   RH66307 Sequence Map: Chr 1|Celera Map Viewer   Position: 220223111-220223237 (bp)   RH66307 Sequence Map: Chr 1 Map Viewer   Position: 246930866-246930992 (bp)   stSG35331 NCBI RH Map: Chr 1 Map Viewer   Position: 2001.5 (cR)   Lod score: 1.72   stSG35331 GeneMap99-GB4 Map: Chr 1 Map Viewer   Position: 764.67 (cR3000)   Lod score: 3.00   Reference Interval: D1S423-qTEL Electronic PCR results RefSeq mRNA (1) NM_016002.2 1901 .. 2027 (127 bp)     mRNA (2) AF151807.1 1551 .. 1677 (127 bp)   BC026185.2 1562 .. 1688 (127 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_927572.1 3580225 .. 3580351 (127 bp)   AC_000044.1 220223111 .. 220223237 (127 bp)   NW_001838554.1 126112 .. 126238 (127 bp)   AC_000133.1 217319455 .. 217319581 (127 bp)   NT_167186.1 40448645 .. 40448771 (127 bp)     Genomic (1) AL591848.13 101586 .. 101712 (127 bp)     Low-pass Sequence Sampling (from GenBank HTGS division) (1) AC087266.1 25561 .. 25687 (127 bp)     ESTs (5 of 68)[Show All Hits] T03696.1 142 .. 268 (127 bp)   T15857.1 142 .. 268 (127 bp)   F08852.1 142 .. 268 (127 bp)   R74175.1 114 .. 241 (128 bp)   H05615.1 166 .. 292 (127 bp)     Whole Genome Shotgun sequences (4) AADD01014544.1 773 .. 899 (127 bp)   AADB02001337.1 74762 .. 74888 (127 bp)   ABBA01031768.1 42710 .. 42836 (127 bp)   ABSL01057774.1 42721 .. 42847 (127 bp)     Patent sequences (5 of 9)[Show All Hits] AX082299.1 1661 .. 1787 (127 bp)   AX408351.1 151 .. 277 (127 bp)   AX779918.1 1922 .. 2048 (127 bp)   BD458653.1 1593 .. 1719 (127 bp)   BD446576.1 1551 .. 1677 (127 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement