PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:3199 Links RH12698 Homo sapiens chromosome 7, locus C7orf20 Found by e-PCR in sequences from Homo sapiens, Macaca nemestrina, Pan troglodytes and Papio anubis. Primer Information Forward primer: AACGGTTCACACAAGCCTTC Reverse primer: GGAGTGAGCAGTCTCCGTTC PCR product size: 190 (bp), Homo sapiens    Homo sapiens Name: RH12698 Also known as: stSG4459 Polymorphism info:   Cross References Gene GeneID: 51608   Symbol: C7orf20   Description: chromosome 7 open reading frame 20   Position: 7p22.3 UniGene Hs.107387 Chromosome 7 open reading frame 20   Hs.703302 Transcribed locus   Hs.708665 CDNA FLJ42155 fis, clone THYMU2003632 Mapping Information stSG4459 GeneMap99-GB4 Map: Chr 7 Map Viewer   Position: 0.42 (cR3000)   Lod score: 0.08   Reference Interval: pTEL-D7S481 Electronic PCR results Genomic (2) BV176746.1 73 .. 262 (190 bp)   BV178968.1 73 .. 262 (190 bp)     ESTs (5 of 56)[Show All Hits] R02578.1 32 .. 221 (190 bp)   R42510.1 45 .. 234 (190 bp)   R44365.1 46 .. 236 (191 bp)   R49698.1 47 .. 237 (191 bp)   R85668.1 8 .. 197 (190 bp)     Patent sequences (2) BD154572.1 27 .. 216 (190 bp)   AX874510.1 27 .. 216 (190 bp)        Macaca nemestrina   Polymorphism info:   Electronic PCR results ESTs (1) DY755200.1 82 .. 275 (194 bp)        Pan troglodytes   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) AADA01136683.1 2806 .. 2995 (190 bp)        Papio anubis   Polymorphism info:   Electronic PCR results Working Draft phase 1 (from GenBank HTGS division) (3) AC146677.1 18911 .. 19104 (194 bp)   AC148429.1 11855 .. 12048 (194 bp)   AC148512.1 21296 .. 21489 (194 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement