PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:29028 Links T16117 Homo sapiens chromosome 11, locus KIAA0652 Pan troglodytes chromosome 11, locus KIAA0652 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Pongo abelii. Primer Information Forward primer: CATTTTGAAGTGTAGCTCGG Reverse primer: AGACCTGCCATGAAAGGAAT PCR product size: 156 (bp), Homo sapiens GenBank Accession: T16117    Homo sapiens Name: T16117 Also known as: IB3510 Polymorphism info:   Cross References Gene GeneID: 9776   Symbol: KIAA0652   Description: KIAA0652   Position: 11p11.2 UniGene Hs.410092 Harbinger transposase derived 1 Mapping Information T16117 Sequence Map: Chr 11|HuRef Map Viewer   Position: 46401913-46402069 (bp)   T16117 Sequence Map: Chr 11 Map Viewer   Position: 46695873-46696029 (bp)   T16117 Sequence Map: Chr 11|Celera Map Viewer   Position: 46844087-46844243 (bp)   IB3510 Whitehead-YAC Map: Chr 11 Map Viewer   Position: 192 (ordinal)   Reference Interval: WC11.5 Electronic PCR results RefSeq mRNA (2) NM_014741.3 4116 .. 4272 (157 bp)   NM_001142673.1 4227 .. 4383 (157 bp)     mRNA (5) AB014552.1 3851 .. 4007 (157 bp)   AF052175.1 1209 .. 1365 (157 bp)   AK000705.1 1827 .. 1983 (157 bp)   BC006191.2 3235 .. 3391 (157 bp)   BC002378.2 3815 .. 3971 (157 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925006.1 42344411 .. 42344567 (157 bp)   AC_000054.1 46844087 .. 46844243 (157 bp)   AC_000143.1 46401913 .. 46402069 (157 bp)   NW_001838022.2 4213973 .. 4214129 (157 bp)   NT_009237.18 46635873 .. 46636029 (157 bp)     Genomic (1) AC115088.6 34845 .. 35001 (157 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC133587.1 136486 .. 136642 (157 bp)     Working Draft phase 2 (from GenBank HTGS division) (1) AC012054.3 79751 .. 79907 (157 bp)     ESTs (5 of 111)[Show All Hits] T16117.1 40 .. 196 (157 bp)   Z40791.1 39 .. 195 (157 bp)   T34891.1 34 .. 190 (157 bp)   R38718.1 44 .. 203 (160 bp)   R42623.1 50 .. 206 (157 bp)     Whole Genome Shotgun sequences (5) AADD01115159.1 12963 .. 13119 (157 bp)   AADC01097893.1 1340 .. 1496 (157 bp)   AADB02013913.1 14317 .. 14473 (157 bp)   ABBA01060733.1 42171 .. 42327 (157 bp)   ABSL01073945.1 42171 .. 42327 (157 bp)     Patent sequences (4) AX409901.1 39 .. 195 (157 bp)   CQ410286.1 156 .. 312 (157 bp)   CQ414250.1 3888 .. 4044 (157 bp)   CQ921490.1 281 .. 437 (157 bp)     Other sequences (3) NR_024587.1 4270 .. 4426 (157 bp)   NR_024588.1 4171 .. 4327 (157 bp)   NR_024589.1 4111 .. 4267 (157 bp)        Pan troglodytes Name: T16117 Polymorphism info:   Cross References Gene GeneID: 451155   Symbol: KIAA0652   Description: KIAA0652   Position:   Mapping Information T16117 Sequence Map: Chr 11 Map Viewer   Position: 47203432-47203588 (bp) Electronic PCR results Genomic RefSeqs (1) NW_001222276.1 16771100 .. 16771256 (157 bp)     ESTs (1) DC529301.1 2354 .. 2510 (157 bp)     Whole Genome Shotgun sequences (2) AADA01228346.1 18835 .. 18991 (157 bp)   AACZ02124430.1 10543 .. 10699 (157 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results RefSeq mRNA (1) NM_001131462.1 3993 .. 4149 (157 bp)     Whole Genome Shotgun sequences (1) ABGA01131035.1 10730 .. 10886 (157 bp)     High Thoughput cDNA sequences (1) CR857710.1 3993 .. 4149 (157 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement