ncbi logo
UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:2703 Links
D12S391
Homo sapiens chromosome 12, polymorphic
Macaca mulatta chromosome 11
Pan troglodytes chromosome 12

Found by e-PCR in sequences from Homo sapiens, Macaca mulatta and Pan troglodytes.

Primer InformationHelp

Forward primer:AACAGGATCAATGGATGCAT
Reverse primer:TGGCTTTTAGACCTGGACTG
PCR product size:211-251 (bp), Homo sapiens
GenBank Accession:G08921

   Homo sapiens
Name: D12S391
Also known as: CHLC.731 CHLC.GATA11H08 CHLC.GATA11H08.731 CHLC.GATA11H08.P6795 GATA-D12S391 GATA-P6795 GATA11H08 GDB:686475 SHGC-17548
Polymorphism info: on genetic map

Cross References Help

Mapping InformationHelp
D12S391 Sequence Map: Chr 12|HuRef Map Viewer
  Position: 12215138-12215358 (bp)
 
D12S391 Sequence Map: Chr 12 Map Viewer
  Position: 12449930-12450154 (bp)
 
D12S391 Sequence Map: Chr 12|Celera Map Viewer
  Position: 17593545-17593768 (bp)
 
D12S391 deCODE Map: Chr 12 Map Viewer
  Position: 27.91 (cM)
 
GATA11H08 Marshfield Map: Chr 12 Map Viewer
  Position: 26.23 (cM)
 
SHGC-17548 NCBI RH Map: Chr 12 Map Viewer
  Position: 167.2 (cR)
  Lod score: 2.35
 
SHGC-17548 Stanford-G3 Map: Chr 12 Map Viewer
  Position: 658 (cR10000)
  Lod score: F
  Reference Interval: 15
 
CHLC.GATA11H08 Whitehead-RH Map: Chr 12 Map Viewer
  Position: 104.1 (cR3000)
  Lod score: P1.08
 
CHLC.GATA11H08 Whitehead-YAC Map: Chr 12 Map Viewer
  Position: 49 (ordinal)
  Reference Interval: WC12.1

Electronic PCR results Help
Genomic RefSeqs (5 of 6)[Show All Hits]
NW_925328.1 2708229 .. 2708452 (224 bp)  
AC_000055.1 17593545 .. 17593768 (224 bp)  
NW_001838052.1 2854621 .. 2854841 (221 bp)  
AC_000144.1 12215138 .. 12215358 (221 bp)  
NT_009714.17 5210054 .. 5210278 (225 bp)  
 
Genomic (2)
G08921.1 57 .. 284 (228 bp)  
AC007621.34 77348 .. 77572 (225 bp)  
 
Whole Genome Shotgun sequences (5 of 7)[Show All Hits]
AADD01121793.1 4045 .. 4265 (221 bp)  
AADC01103750.1 941 .. 1153 (213 bp)  
AADB02014689.1 3930 .. 4153 (224 bp)  
ABBA01107516.1 386 .. 594 (209 bp)  
ABBA01067832.1 8130 .. 8350 (221 bp)  
 
Patent sequences (3)
CS459537.1 97373 .. 97597 (225 bp)  
DJ466016.1 1 .. 225 (225 bp)  
DL005612.1 97373 .. 97597 (225 bp)  
 

   Macaca mulatta
Name: D12S391
Polymorphism info:  
Mapping InformationHelp
D12S391 Sequence Map: Chr Un|NW_001204399.1 Map Viewer
  Position: 639-1027 (bp)
 
D12S391 Sequence Map: Chr 11 Map Viewer
  Position: 12652938-12653330 (bp)

Electronic PCR results Help
Genomic RefSeqs (2)
NW_001096616.1 1302428 .. 1302820 (393 bp)  
NW_001204399.1 639 .. 1027 (389 bp)  
 
Whole Genome Shotgun sequences (2)
AANU01254314.1 6586 .. 6978 (393 bp)  
AANU01068518.1 639 .. 1027 (389 bp)  
 

   Pan troglodytes
Name: D12S391
Polymorphism info:  
Mapping InformationHelp
D12S391 Sequence Map: Chr 12 Map Viewer
  Position: 12697828-12698016 (bp)

Electronic PCR results Help
Genomic RefSeqs (1)
NW_001223150.1 4060461 .. 4060649 (189 bp)  
 
Genomic (1)
AC195410.3 159497 .. 159685 (189 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (1)
AC214188.4 8517 .. 8705 (189 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01228471.1 750 .. 938 (189 bp)  
AACZ02132159.1 8471 .. 8659 (189 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement