PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:26611 Links RH78044 Homo sapiens chromosome 12, locus ANKLE2 Macaca mulatta chromosome 11, locus LOC721686 Pan troglodytes chromosome 12, locus ANKLE2 Found by e-PCR in sequences from Homo sapiens, Macaca fascicularis, Macaca mulatta, Pan troglodytes and Pongo abelii. Primer Information Forward primer: CAGGCTTTACTGGAGCAAGG Reverse primer: GATCAGTTGGGTTCCCTTCA PCR product size: 122 (bp), Homo sapiens    Homo sapiens Name: RH78044 Also known as: stSG40199 Polymorphism info:   Cross References Gene GeneID: 23141   Symbol: ANKLE2   Description: ankyrin repeat and LEM domain containing 2   Position: 12q24.33 UniGene Hs.654628 Ankyrin repeat and LEM domain containing 2 Mapping Information RH78044 Sequence Map: Chr 12|HuRef Map Viewer   Position: 130109465-130109585 (bp)   RH78044 Sequence Map: Chr 12|Celera Map Viewer   Position: 133030733-133030853 (bp)   RH78044 Sequence Map: Chr 12 Map Viewer   Position: 133331459-133331579 (bp)   stSG40199 GeneMap99-GB4 Map: Chr 12 Map Viewer   Position: 503.25 (cR3000)   Lod score: 0.28   Reference Interval: D12S97-qTEL Electronic PCR results RefSeq mRNA (1) NM_015114.1 389 .. 509 (121 bp)     mRNA (1) BC043157.1 358 .. 478 (121 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925428.1 482837 .. 482957 (121 bp)   AC_000055.1 133030733 .. 133030853 (121 bp)   AC_000144.1 130109465 .. 130109585 (121 bp)   NW_001838068.2 508272 .. 508392 (121 bp)   NT_024477.14 524467 .. 524587 (121 bp)     Genomic (2) AC136467.11 7926 .. 8046 (121 bp)   BV180587.1 161 .. 281 (121 bp)     ESTs (5 of 68)[Show All Hits] R43429.1 115 .. 236 (122 bp)   AA292930.1 115 .. 235 (121 bp)   AA832360.1 103 .. 223 (121 bp)   AA872599.1 115 .. 235 (121 bp)   AA913675.1 116 .. 236 (121 bp)     Whole Genome Shotgun sequences (4) AADD01129579.1 2094 .. 2214 (121 bp)   AADB02015904.1 494 .. 614 (121 bp)   ABBA01042549.1 476 .. 596 (121 bp)   ABSL01042228.1 476 .. 596 (121 bp)     Patent sequences (5 of 7)[Show All Hits] AX048080.1 136 .. 256 (121 bp)   AX053660.1 165 .. 285 (121 bp)   AX277631.1 262 .. 382 (121 bp)   BD206026.1 262 .. 382 (121 bp)   BD276516.1 136 .. 256 (121 bp)        Macaca fascicularis   Polymorphism info:   Cross References UniGene Mfa.7055 Testis cDNA, clone: QtsA-17443 Electronic PCR results mRNA (1) AB169132.1 405 .. 525 (121 bp)        Macaca mulatta Name: RH78044 Polymorphism info:   Cross References Gene GeneID: 721686   Symbol: LOC721686   Description: hypothetical protein LOC721686   Position:   Mapping Information RH78044 Sequence Map: Chr 11|NW_001098140.1 Map Viewer   Position: 1200-1320 (bp) Electronic PCR results RefSeq mRNA (1) XM_001117881.1 130 .. 250 (121 bp)     Genomic RefSeqs (1) NW_001098140.1 1200 .. 1320 (121 bp)     Whole Genome Shotgun sequences (1) AANU01039759.1 1200 .. 1320 (121 bp)        Pan troglodytes Name: RH78044 Polymorphism info:   Cross References Gene GeneID: 467166   Symbol: ANKLE2   Description: ankyrin repeat and LEM domain containing 2   Position:   Mapping Information RH78044 Sequence Map: Chr 12 Map Viewer   Position: 134886007-134886127 (bp) Electronic PCR results RefSeq mRNA (1) XM_001152324.1 388 .. 508 (121 bp)     Genomic RefSeqs (1) NW_001223212.1 13152 .. 13272 (121 bp)     Whole Genome Shotgun sequences (2) AADA01291554.1 586 .. 706 (121 bp)   AACZ02140045.1 8284 .. 8404 (121 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results ESTs (1) CR751793.1 140 .. 260 (121 bp)     Whole Genome Shotgun sequences (1) ABGA01160138.1 272 .. 392 (121 bp)     High Thoughput cDNA sequences (1) CR858180.1 140 .. 260 (121 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement