PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:26484 Links D16S2946 Homo sapiens chromosome 16, loci KIAA0174 and PKD1L3 Macaca mulatta chromosome 20;3, loci LOC718932, KIAA0174, and LOC707143 Pan troglodytes chromosome 16;12, locus LOC745404 Found by e-PCR in sequences from Homo sapiens, Macaca mulatta, Pan troglodytes and Papio anubis. Primer Information Forward primer: CAGGATCTTTAACTTTATTAGCAGC Reverse primer: GTGCCCATGCAGCTGTAGTT PCR product size: 249-250 (bp), Homo sapiens GenBank Accession: G06036 Z38301    Homo sapiens Name: D16S2946 Also known as: GDB:588052 HSC05G072 SHGC-60946 WI-6284 Polymorphism info:   Cross References Gene GeneID: 342372   Symbol: PKD1L3   Description: polycystic kidney disease 1-like 3   Position: 16q22.2 Gene GeneID: 9798   Symbol: KIAA0174   Description: KIAA0174   Position: 16q22.2 UniGene Hs.232194 KIAA0174   Hs.651115 Transcribed locus, strongly similar to NP_001017454.1 hypothetical protein L... Mapping Information D16S2946 Sequence Map: Chr 16|Celera Map Viewer   Position: 56276573-56276822 (bp)   D16S2946 Sequence Map: Chr 16|HuRef Map Viewer   Position: 57729839-57730088 (bp)   D16S2946 Sequence Map: Chr 16 Map Viewer   Position: 71962657-71962906 (bp)   WI-6284 Whitehead-YAC Map: Chr 16 Map Viewer   Position: 196 (ordinal)   Reference Interval: WC16.8 Electronic PCR results RefSeq mRNA (1) NM_014761.2 2100 .. 2349 (250 bp)     mRNA (5 of 8)[Show All Hits] D79996.1 2099 .. 2348 (250 bp)   AL355695.1 1152 .. 1401 (250 bp)   BC000116.1 2001 .. 2250 (250 bp)   BC004359.1 2100 .. 2349 (250 bp)   AK057902.1 2117 .. 2366 (250 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NT_010498.15 25576856 .. 25577105 (250 bp)   NW_926517.1 768711 .. 768960 (250 bp)   AC_000059.1 56276573 .. 56276822 (250 bp)   NW_001838325.1 543133 .. 543382 (250 bp)   AC_000148.1 57729839 .. 57730088 (250 bp)     Genomic (2) G06036.1 1 .. 250 (250 bp)   AC009127.10 83381 .. 83630 (250 bp)     ESTs (5 of 201)[Show All Hits] T17335.1 3 .. 252 (250 bp)   Z38301.1 1 .. 250 (250 bp)   T33794.1 3 .. 252 (250 bp)   T64968.1 5 .. 255 (251 bp)   T99788.1 2 .. 252 (251 bp)     Whole Genome Shotgun sequences (5) AADD01149895.1 1098 .. 1347 (250 bp)   AADC01126848.1 15769 .. 16018 (250 bp)   AADB02017649.1 944120 .. 944369 (250 bp)   ABBA01016792.1 9904 .. 10153 (250 bp)   ABSL01045468.1 9904 .. 10153 (250 bp)     Patent sequences (5 of 20)[Show All Hits] BD186186.1 2075 .. 2324 (250 bp)   BD186187.1 1305 .. 1554 (250 bp)   BD186188.1 2133 .. 2382 (250 bp)   BD190288.1 2099 .. 2348 (250 bp)   BD190290.1 1305 .. 1554 (250 bp)     High Thoughput cDNA sequences (1) BC006261.1 2912 .. 3161 (250 bp)        Macaca mulatta Name: D16S2946 Polymorphism info:   Cross References Gene GeneID: 707143   Symbol: LOC707143   Description: similar to polycystic kidney disease 1 like 3   Position:   Gene GeneID: 707245   Symbol: KIAA0174   Description: KIAA0174   Position:   Gene GeneID: 718932   Symbol: LOC718932   Description: similar to putative MAPK activating protein PM28   Position:   UniGene Mmu.13031 KIAA0174 Mapping Information D16S2946 Sequence Map: Chr 3 Map Viewer   Position: 46980186-46980430 (bp)   D16S2946 Sequence Map: Chr 20 Map Viewer   Position: 70722482-70722726 (bp) Electronic PCR results RefSeq mRNA (5 of 7)[Show All Hits] XM_001112317.1 1306 .. 1550 (245 bp)   XM_001104896.1 1472 .. 1716 (245 bp)   XM_001105424.1 2142 .. 2386 (245 bp)   XM_001105348.1 2100 .. 2344 (245 bp)   XM_001105281.1 2049 .. 2293 (245 bp)     Genomic RefSeqs (2) NW_001114199.1 1030373 .. 1030617 (245 bp)   NW_001111354.1 6804148 .. 6804392 (245 bp)     Genomic (1) AC197751.3 168874 .. 169118 (245 bp)     ESTs (1) CB310489.1 7 .. 251 (245 bp)     Whole Genome Shotgun sequences (2) AANU01177709.1 15169 .. 15413 (245 bp)   AANU01101874.1 16224 .. 16468 (245 bp)        Pan troglodytes Name: D16S2946 Polymorphism info:   Cross References Gene GeneID: 745404   Symbol: LOC745404   Description: similar to KIAA0174   Position:   Mapping Information D16S2946 Sequence Map: Chr 12 Map Viewer   Position: 33991914-33992162 (bp)   D16S2946 Sequence Map: Chr 16 Map Viewer   Position: 71797677-71797926 (bp) Electronic PCR results RefSeq mRNA (1) XM_001151193.1 2447 .. 2696 (250 bp)     Genomic RefSeqs (2) NW_001223153.1 12614772 .. 12615020 (249 bp)   NW_001226058.1 1771033 .. 1771282 (250 bp)     Genomic (1) AC195070.2 126895 .. 127143 (249 bp)     Whole Genome Shotgun sequences (4) AADA01285054.1 2104 .. 2353 (250 bp)   AADA01153961.1 2673 .. 2921 (249 bp)   AACZ02164143.1 2611 .. 2860 (250 bp)   AACZ02133406.1 1847 .. 2095 (249 bp)        Papio anubis   Polymorphism info:   Electronic PCR results Working Draft phase 2 (from GenBank HTGS division) (1) AC141417.16 68621 .. 68864 (244 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement