PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:240635 Links FGA Homo sapiens chromosome 4, locus FGA Macaca mulatta chromosome 5, locus FGA Pan troglodytes chromosome 4, locus FGA Found by e-PCR in sequences from Homo sapiens, Macaca mulatta, Pan troglodytes and Pongo abelii. Primer Information Forward primer: GCCCCATAGGTTTTGAACTCA Reverse primer: TGATTTGTCTGTAATTGCCAGC PCR product size: 308-464 (bp), Homo sapiens    Homo sapiens Name: FGA Polymorphism info:   Cross References Gene GeneID: 2243   Symbol: FGA   Description: fibrinogen alpha chain   Position: 4q28 UniGene Hs.351593 Fibrinogen alpha chain Mapping Information FGA Sequence Map: Chr 4|HuRef Map Viewer   Position: 151249429-151249620 (bp)   FGA Sequence Map: Chr 4|Celera Map Viewer   Position: 152839814-152840008 (bp)   FGA Sequence Map: Chr 4 Map Viewer   Position: 155508848-155509043 (bp) Electronic PCR results Genomic RefSeqs (5 of 7)[Show All Hits] NW_922217.1 35097293 .. 35097487 (195 bp)   AC_000047.1 152839814 .. 152840008 (195 bp)   NW_001838921.1 15731668 .. 15731859 (192 bp)   AC_000136.1 151249429 .. 151249620 (192 bp)   NG_008832.1 7855 .. 8050 (196 bp)     Genomic (4) M64982.1 2825 .. 3016 (192 bp)   AF361104.2 5078 .. 5277 (200 bp)   AC107385.4 63434 .. 63629 (196 bp)   AY749636.1 1 .. 205 (205 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC009583.4 284177 .. 284372 (196 bp)     ESTs (1) DA640548.1 162 .. 357 (196 bp)     Whole Genome Shotgun sequences (5 of 7)[Show All Hits] AADD01052616.1 4510 .. 4705 (196 bp)   AADC01045796.1 46551 .. 46762 (212 bp)   AADB02007753.1 332644 .. 332838 (195 bp)   ABBA01152722.1 555 .. 766 (212 bp)   ABBA01070158.1 4573 .. 4764 (192 bp)     Patent sequences (2) CS071157.1 2825 .. 3016 (192 bp)   BD460068.1 2825 .. 3016 (192 bp)        Macaca mulatta Name: FGA Polymorphism info:   Cross References Gene GeneID: 698244   Symbol: FGA   Description: fibrinogen alpha chain   Position:   Mapping Information FGA Sequence Map: Chr 5 Map Viewer   Position: 146789595-146789809 (bp) Electronic PCR results Genomic RefSeqs (1) NW_001118162.1 5517206 .. 5517420 (215 bp)     Genomic (1) AC191446.4 157927 .. 158141 (215 bp)     Whole Genome Shotgun sequences (1) AANU01272452.1 4519 .. 4733 (215 bp)        Pan troglodytes Name: FGA Polymorphism info:   Cross References Gene GeneID: 461559   Symbol: FGA   Description: fibrinogen alpha chain   Position:   Mapping Information FGA Sequence Map: Chr 4 Map Viewer   Position: 158799622-158799816 (bp) Electronic PCR results Genomic RefSeqs (1) NW_001234090.1 457931 .. 458125 (195 bp)     Whole Genome Shotgun sequences (2) AADA01049187.1 18296 .. 18490 (195 bp)   AACZ02053636.1 29283 .. 29477 (195 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01134518.1 29998 .. 30230 (233 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement