PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:22935 Links WI-18020 Homo sapiens chromosome 11, locus CWC15 Pan troglodytes chromosome 11, locus CWC15 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Pongo abelii. Primer Information Forward primer: CAAGAAGAGCTGCAGTATCATCA Reverse primer: GTGTTTTGGTAGTGTGTATTTTCCC PCR product size: 115 (bp), Homo sapiens GenBank Accession: G21537 R99846    Homo sapiens Name: WI-18020 Also known as: EST349267 Polymorphism info:   Cross References Gene GeneID: 51503   Symbol: CWC15   Description: CWC15 spliceosome-associated protein homolog (S. cerevisiae)   Position: 11q21 UniGene Hs.503597 CWC15 homolog (S. cerevisiae)   Hs.711449 Transcribed locus Mapping Information WI-18020 Sequence Map: Chr 11|HuRef Map Viewer   Position: 90768144-90768258 (bp)   WI-18020 Sequence Map: Chr 11|Celera Map Viewer   Position: 91990990-91991104 (bp)   WI-18020 Sequence Map: Chr 11 Map Viewer   Position: 94703203-94703317 (bp)   WI-18020 Whitehead-RH Map: Chr 11 Map Viewer   Position: 417.5 (cR3000)   Lod score: P1.27   WI-18020 GeneMap99-GB4 Map: Chr 11 Map Viewer   Position: 318.96 (cR3000)   Lod score: 2.37   Reference Interval: D11S1311-D11S917 Electronic PCR results Genomic RefSeqs (5 of 6)[Show All Hits] NW_925173.1 4859890 .. 4860004 (115 bp)   AC_000054.1 91990990 .. 91991104 (115 bp)   AC_000143.1 90768144 .. 90768258 (115 bp)   NW_001838042.2 25918751 .. 25918865 (115 bp)   NT_167190.1 40008998 .. 40009112 (115 bp)     Genomic (2) G21537.1 9 .. 123 (115 bp)   AP002383.3 93010 .. 93124 (115 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AC032024.3 50821 .. 50935 (115 bp)   AC023756.3 14466 .. 14580 (115 bp)     ESTs (5 of 6)[Show All Hits] R99846.1 9 .. 123 (115 bp)   AW592913.1 338 .. 453 (116 bp)   AW978868.1 341 .. 455 (115 bp)   BG218170.1 10 .. 124 (115 bp)   CA776365.1 343 .. 457 (115 bp)     Whole Genome Shotgun sequences (4) AADC01101210.1 288528 .. 288642 (115 bp)   AADB02014322.1 1020422 .. 1020536 (115 bp)   ABBA01040022.1 46875 .. 46989 (115 bp)   ABSL01063342.1 46876 .. 46990 (115 bp)     Patent sequences (2) CQ491517.1 745 .. 859 (115 bp)   CQ497402.1 745 .. 859 (115 bp)        Pan troglodytes Name: WI-18020 Polymorphism info:   Cross References Gene GeneID: 451493   Symbol: CWC15   Description: CWC15 spliceosome-associated protein homolog (S. cerevisiae)   Position:   Mapping Information WI-18020 Sequence Map: Chr 11 Map Viewer   Position: 93500973-93501087 (bp) Electronic PCR results Genomic RefSeqs (1) NW_001222310.1 4944049 .. 4944163 (115 bp)     Whole Genome Shotgun sequences (2) AADA01074871.1 12145 .. 12259 (115 bp)   AACZ02127356.1 12315 .. 12429 (115 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01170347.1 16219 .. 16333 (115 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement