PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:22934 Links WI-11443 Bos taurus chromosome 18, loci LOC785843, CWC15, and LOC505697 Equus caballus locus LOC100061007 Homo sapiens chromosome 11, locus CWC15 Macaca mulatta locus CWC15 Pan troglodytes locus CWC15 Found by e-PCR in sequences from Aedes aegypti, Bos sp., Bos taurus, Cavia porcellus, Equus caballus, Eubalaena glacialis, Felis catus, Homo sapiens, Macaca fascicularis, Macaca mulatta, Oryctolagus cuniculus, Ovis aries, Pan troglodytes, Papio anubis, Pongo abelii, Spermophilus tridecemlineatus and Tursiops truncatus. Primer Information Forward primer: CAAGAAGAGCTGCAGTATCATCA Reverse primer: CAGAACATACAACCTCCTCTTCA PCR product size: 150 (bp), Homo sapiens GenBank Accession: G21474 T89356    Aedes aegypti   Polymorphism info:   Electronic PCR results ESTs (2) DV375939.1 340 .. 489 (150 bp)   DV375940.1 192 .. 341 (150 bp)        Bos sp.   Polymorphism info:   Electronic PCR results ESTs (2) AM013311.1 632 .. 787 (156 bp)   AM013996.1 181 .. 336 (156 bp)        Bos taurus Name: WI-11443 Polymorphism info:   Cross References Gene GeneID: 505697   Symbol: LOC505697   Description: similar to Ryanodine receptor 1 (Skeletal muscle-type ryanodine receptor) (RyR1) (RYR-1) (Skeletal muscle calcium release channel)   Position:   Gene GeneID: 535258   Symbol: CWC15   Description: CWC15 spliceosome-associated protein homolog (S. cerevisiae)   Position:   Gene GeneID: 785843   Symbol: LOC785843   Description: similar to CWC15 homolog   Position:   UniGene Bt.1333 Hypothetical protein LOC785843   Bt.1540 CWC15 homolog (S. cerevisiae) Mapping Information WI-11443 Sequence Map: Chr 18 Map Viewer   Position: 48019833-48019988 (bp) Electronic PCR results RefSeq mRNA (1) NM_001046399.1 398 .. 553 (156 bp)     mRNA (1) BC105398.1 398 .. 553 (156 bp)     Genomic RefSeqs (2) NW_001493278.2 4556769 .. 4558332 (1564 bp)   NW_001493607.2 3076578 .. 3076733 (156 bp)     Genomic (2) DAAA02047036.1 14482 .. 14637 (156 bp)   DAAA02040141.1 79967 .. 81530 (1564 bp)     Working Draft phase 1 (from GenBank HTGS division) (3) AC164058.3 33660 .. 35223 (1564 bp)   AC159559.3 176267 .. 176422 (156 bp)   AC160784.3 94057 .. 94212 (156 bp)     ESTs (5 of 93)[Show All Hits] CB222677.1 305 .. 460 (156 bp)   CB437556.1 305 .. 460 (156 bp)   CF614934.1 311 .. 466 (156 bp)   CF763281.1 385 .. 540 (156 bp)   CF765974.1 381 .. 536 (156 bp)     Whole Genome Shotgun sequences (2) AAFC03095769.1 10331 .. 10486 (156 bp)   AAFC03007157.1 33660 .. 35223 (1564 bp)        Cavia porcellus   Polymorphism info:   Electronic PCR results ESTs (2) EB366215.1 106 .. 255 (150 bp)   EB369274.1 239 .. 388 (150 bp)     Whole Genome Shotgun sequences (1) AAKN02037639.1 36583 .. 37871 (1289 bp)        Equus caballus   Polymorphism info:   Cross References Gene GeneID: 100061007   Symbol: LOC100061007   Description: hypothetical protein LOC100061007   Position:   UniGene Eca.8699 Hypothetical protein LOC100061007 Electronic PCR results RefSeq mRNA (1) XM_001498743.2 242 .. 394 (153 bp)     Genomic RefSeqs (1) NW_001867425.1 6137745 .. 6139056 (1312 bp)     ESTs (2) CX600915.1 289 .. 444 (156 bp)   CX601231.1 257 .. 412 (156 bp)     Whole Genome Shotgun sequences (1) AAWR02020592.1 64857 .. 66168 (1312 bp)        Eubalaena glacialis   Polymorphism info:   Electronic PCR results ESTs (1) ES557314.1 33 .. 188 (156 bp)        Felis catus   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (3) AANG01072747.1 1602 .. 3125 (1524 bp)   ACBE01347222.1 2822 .. 2977 (156 bp)   ACBE01337944.1 1158 .. 2681 (1524 bp)        Homo sapiens Name: WI-11443 Also known as: EST159477 Polymorphism info:   Cross References Gene GeneID: 51503   Symbol: CWC15   Description: CWC15 spliceosome-associated protein homolog (S. cerevisiae)   Position: 11q21 UniGene Hs.503597 CWC15 homolog (S. cerevisiae) Mapping Information WI-11443 NCBI RH Map: Chr 11 Map Viewer   Position: 794.1 (cR)   Lod score: 1.11   WI-11443 Whitehead-RH Map: Chr 11 Map Viewer   Position: 416.2 (cR3000)   Lod score: P0.02   WI-11443 GeneMap99-GB4 Map: Chr 11 Map Viewer   Position: 319.17 (cR3000)   Lod score: 3.00   Reference Interval: D11S1311-D11S917 Electronic PCR results RefSeq mRNA (1) NM_016403.3 365 .. 514 (150 bp)     mRNA (4) AF110775.1 305 .. 454 (150 bp)   AJ250393.1 322 .. 471 (150 bp)   BC040946.1 317 .. 466 (150 bp)   AK225956.1 324 .. 473 (150 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925173.1 4859890 .. 4860919 (1030 bp)   AC_000054.1 91990990 .. 91992019 (1030 bp)   AC_000143.1 90768144 .. 90769173 (1030 bp)   NW_001838042.2 25917836 .. 25918865 (1030 bp)   NT_167190.1 40008998 .. 40010027 (1030 bp)     Genomic (3) G21474.1 1 .. 150 (150 bp)   AP002383.3 93010 .. 94039 (1030 bp)   DQ046616.1 242 .. 391 (150 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AC032024.3 50821 .. 51850 (1030 bp)   AC023756.3 14466 .. 15496 (1031 bp)     ESTs (5 of 186)[Show All Hits] T89356.1 1 .. 150 (150 bp)   W07735.1 290 .. 444 (155 bp)   W39225.1 272 .. 424 (153 bp)   W72164.1 290 .. 439 (150 bp)   W73840.1 297 .. 446 (150 bp)     Whole Genome Shotgun sequences (4) AADC01101210.1 288528 .. 289557 (1030 bp)   AADB02014322.1 1020422 .. 1021451 (1030 bp)   ABBA01040022.1 45960 .. 46989 (1030 bp)   ABSL01063342.1 45961 .. 46990 (1030 bp)     Patent sequences (5 of 24)[Show All Hits] AX017873.1 346 .. 495 (150 bp)   AX354374.1 337 .. 486 (150 bp)   BD109176.1 362 .. 511 (150 bp)   BD137283.1 346 .. 495 (150 bp)   BD276359.1 358 .. 507 (150 bp)     High Thoughput cDNA sequences (5 of 7)[Show All Hits] AF161497.1 305 .. 454 (150 bp)   BC006975.1 328 .. 477 (150 bp)   BC032629.1 323 .. 472 (150 bp)   CR596277.1 279 .. 428 (150 bp)   CR599874.1 608 .. 757 (150 bp)        Macaca fascicularis   Polymorphism info:   Electronic PCR results ESTs (3) DC640971.1 315 .. 464 (150 bp)   DK576696.1 301 .. 450 (150 bp)   DK578814.1 311 .. 460 (150 bp)        Macaca mulatta   Polymorphism info:   Cross References Gene GeneID: 698332   Symbol: CWC15   Description: CWC15 spliceosome-associated protein homolog (S. cerevisiae)   Position:   UniGene Mmu.4254 Similar to RIKEN cDNA 0610040D20 Electronic PCR results RefSeq mRNA (1) XM_001089958.1 365 .. 514 (150 bp)     Genomic RefSeqs (1) NW_001100390.1 712566 .. 713587 (1022 bp)     ESTs (5 of 9)[Show All Hits] CB310077.1 333 .. 482 (150 bp)   CB311317.1 331 .. 480 (150 bp)   CB552619.1 274 .. 423 (150 bp)   CD766841.1 332 .. 481 (150 bp)   CN641728.1 293 .. 441 (149 bp)     Whole Genome Shotgun sequences (1) AANU01120486.1 17211 .. 18232 (1022 bp)        Oryctolagus cuniculus   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) AAGW02008785.1 7116 .. 8260 (1145 bp)        Ovis aries   Polymorphism info:   Cross References UniGene Oar.9380 Transcribed locus, strongly similar to NP_001020158.1 hypothetical protein L... Electronic PCR results ESTs (5 of 19)[Show All Hits] DY512049.1 322 .. 477 (156 bp)   EE749122.1 432 .. 587 (156 bp)   EE750510.1 241 .. 396 (156 bp)   EE770438.1 303 .. 459 (157 bp)   EE775530.1 309 .. 464 (156 bp)        Pan troglodytes   Polymorphism info:   Cross References Gene GeneID: 451493   Symbol: CWC15   Description: CWC15 spliceosome-associated protein homolog (S. cerevisiae)   Position:   Electronic PCR results RefSeq mRNA (3) XM_001144067.1 520 .. 669 (150 bp)   XM_508705.2 337 .. 486 (150 bp)   XM_001144223.1 365 .. 514 (150 bp)     Genomic RefSeqs (1) NW_001222310.1 4944049 .. 4945083 (1035 bp)     Whole Genome Shotgun sequences (2) AADA01074871.1 11225 .. 12259 (1035 bp)   AACZ02127356.1 11395 .. 12429 (1035 bp)        Papio anubis   Polymorphism info:   Electronic PCR results ESTs (5 of 78)[Show All Hits] FC111790.1 312 .. 461 (150 bp)   FC111373.1 306 .. 455 (150 bp)   FC112361.1 329 .. 478 (150 bp)   FC115802.1 312 .. 461 (150 bp)   FC117007.1 332 .. 481 (150 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results RefSeq mRNA (1) NM_001133743.1 330 .. 479 (150 bp)     Whole Genome Shotgun sequences (1) ABGA01170347.1 15307 .. 16333 (1027 bp)     High Thoughput cDNA sequences (1) CR857672.1 330 .. 479 (150 bp)        Spermophilus tridecemlineatus   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) AAQQ01596911.1 4505 .. 5587 (1083 bp)        Tursiops truncatus   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (2) ABRN01351197.1 1965 .. 2114 (150 bp)   ABRN01449265.1 2873 .. 3249 (377 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement