PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:21049 Links D7S370 Homo sapiens chromosome 7, locus SCRN1 Macaca mulatta chromosome 3, locus SCRN1 Pan troglodytes chromosome 7, locus SCRN1 Found by e-PCR in sequences from Homo sapiens, Macaca mulatta, Pan troglodytes, Papio anubis and Pongo abelii. Primer Information Forward primer: ATTGACTCCAAACATCCC Reverse primer: TAGCATTTTCCATCTAACAC PCR product size: 110 (bp), Homo sapiens GenBank Accession: G28646    Homo sapiens Name: D7S370 Also known as: GDB:3754185 PMU74 sWSS1340 Polymorphism info:   Cross References Gene GeneID: 9805   Symbol: SCRN1   Description: secernin 1   Position: 7p14.3-p14.1 UniGene Hs.520740 Secernin 1   Hs.601501 Transcribed locus Mapping Information D7S370 Sequence Map: Chr 7|HuRef Map Viewer   Position: 29841592-29841701 (bp)   D7S370 Sequence Map: Chr 7|Celera Map Viewer   Position: 29949296-29949405 (bp)   D7S370 Sequence Map: Chr 7 Map Viewer   Position: 29959908-29960017 (bp)   D7S370 Sequence Map: Chr 7|CRA_TCAGchr7v2 Map Viewer   Position: 30009731-30009840 (bp)   sWSS1340 NHGRI-7 Map: Chr 7     Reference Interval: E :pos244 Electronic PCR results RefSeq mRNA (4) NM_014766.4 4970 .. 5079 (110 bp)   NM_001145514.1 4910 .. 5019 (110 bp)   NM_001145515.1 4810 .. 4919 (110 bp)   NM_001145513.1 4978 .. 5087 (110 bp)     mRNA (4) G31727.1 182 .. 291 (110 bp)   D83777.2 4913 .. 5022 (110 bp)   BC040492.1 4922 .. 5031 (110 bp)   AB071705.1 4860 .. 4969 (110 bp)     Genomic RefSeqs (5 of 8)[Show All Hits] NW_923240.1 23120161 .. 23120270 (110 bp)   NT_079592.2 29959731 .. 29959840 (110 bp)   AC_000050.1 29949296 .. 29949405 (110 bp)   AC_000068.1 30009731 .. 30009840 (110 bp)   NW_001839003.1 23684817 .. 23684926 (110 bp)     Genomic (2) G28646.1 67 .. 176 (110 bp)   AC004912.2 115766 .. 115875 (110 bp)     ESTs (5 of 147)[Show All Hits] T03756.1 182 .. 291 (110 bp)   T15989.1 182 .. 291 (110 bp)   T33340.1 182 .. 291 (110 bp)   T34787.1 219 .. 330 (112 bp)   H42999.1 168 .. 277 (110 bp)     Whole Genome Shotgun sequences (5 of 6)[Show All Hits] AADD01079720.1 34766 .. 34875 (110 bp)   AADC01067024.1 131461 .. 131570 (110 bp)   AACC02000087.1 2744564 .. 2744673 (110 bp)   AADB02010433.1 2154946 .. 2155055 (110 bp)   ABBA01056806.1 35988 .. 36097 (110 bp)     Patent sequences (5 of 11)[Show All Hits] AX329597.1 4949 .. 5058 (110 bp)   BD186742.1 160 .. 269 (110 bp)   AX779891.1 4949 .. 5058 (110 bp)   AX961980.1 4860 .. 4969 (110 bp)   CQ726444.1 4947 .. 5056 (110 bp)        Macaca mulatta Name: D7S370 Polymorphism info:   Cross References Gene GeneID: 696370   Symbol: SCRN1   Description: secernin 1   Position:   UniGene Mmu.14591 Secernin 1 Mapping Information D7S370 Sequence Map: Chr 3 Map Viewer   Position: 96285275-96285384 (bp) Electronic PCR results RefSeq mRNA (3) XM_001086756.1 4819 .. 4928 (110 bp)   XM_001086879.1 5216 .. 5325 (110 bp)   XM_001086984.1 4919 .. 5028 (110 bp)     Genomic RefSeqs (1) NW_001114275.1 223936 .. 224045 (110 bp)     Whole Genome Shotgun sequences (1) AANU01125620.1 5916 .. 6025 (110 bp)        Pan troglodytes Name: D7S370 Polymorphism info:   Cross References Gene GeneID: 463323   Symbol: SCRN1   Description: secernin 1   Position:   Mapping Information D7S370 Sequence Map: Chr 7 Map Viewer   Position: 30287429-30287538 (bp) Electronic PCR results RefSeq mRNA (1) XM_519021.2 4920 .. 5029 (110 bp)     Genomic RefSeqs (1) NW_001237933.1 23402243 .. 23402352 (110 bp)     Genomic (1) AC187736.3 167930 .. 168039 (110 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC146158.1 157870 .. 157979 (110 bp)     Working Draft phase 2 (from GenBank HTGS division) (2) AC091622.2 37171 .. 37280 (110 bp)   AC094110.2 116194 .. 116303 (110 bp)     Whole Genome Shotgun sequences (2) AADA01257094.1 4354 .. 4463 (110 bp)   AACZ02082051.1 71735 .. 71844 (110 bp)        Papio anubis   Polymorphism info:   Electronic PCR results Genomic (2) AC091713.4 211833 .. 211942 (110 bp)   AC097004.3 78702 .. 78811 (110 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01275414.1 15919 .. 16028 (110 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement