PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:20935 Links A009Z21 Homo sapiens chromosome 14, locus KIAA0831 Pan troglodytes locus LOC744098 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes, Papio anubis and Pongo abelii. Primer Information Forward primer: ATTCTCGGACACTAGTCTCT Reverse primer: TGTAAGGGGGAAAAACAGTA PCR product size: 115 (bp), Homo sapiens    Homo sapiens Name: A009Z21 Also known as: Polymorphism info:   Cross References Gene GeneID: 22863   Symbol: KIAA0831   Description: KIAA0831   Position: 14q22.3 UniGene Hs.414809 KIAA0831   Hs.540030 Transcribed locus Mapping Information A009Z21 GeneMap99-GB4 Map: Chr 14 Map Viewer   Position: 124.97 (cR3000)   Lod score: F   Reference Interval: D14S281-D14S980 Electronic PCR results RefSeq mRNA (1) NM_014924.3 4509 .. 4623 (115 bp)     mRNA (4) AB020638.1 4710 .. 4824 (115 bp)   AL049978.1 579 .. 693 (115 bp)   AK131251.1 4509 .. 4623 (115 bp)   BR000826.1 4509 .. 4623 (115 bp)     Genomic (3) G33017.1 1 .. 115 (115 bp)   AL356801.5 146879 .. 146993 (115 bp)   AL158801.4 13340 .. 13454 (115 bp)     ESTs (4) T99335.1 122 .. 237 (116 bp)   AW812917.1 447 .. 561 (115 bp)   BE218618.1 189 .. 303 (115 bp)   BQ307677.1 303 .. 417 (115 bp)     Patent sequences (5 of 6)[Show All Hits] CQ845786.1 4509 .. 4623 (115 bp)   CQ919331.1 352 .. 466 (115 bp)   BD397010.1 1244 .. 1358 (115 bp)   CS539857.1 4509 .. 4623 (115 bp)   DL209841.1 4509 .. 4623 (115 bp)     High Thoughput cDNA sequences (1) BC028015.1 1087 .. 1201 (115 bp)        Pan troglodytes   Polymorphism info:   Cross References Gene GeneID: 744098   Symbol: LOC744098   Description: similar to KIAA0831 protein   Position:   Electronic PCR results RefSeq mRNA (2) XM_001162169.1 4555 .. 4673 (119 bp)   XM_001162127.1 4553 .. 4671 (119 bp)     Whole Genome Shotgun sequences (1) AADA01051554.1 2735 .. 2853 (119 bp)        Papio anubis   Polymorphism info:   Electronic PCR results ESTs (2) GE848081.1 483 .. 601 (119 bp)   GE878913.1 483 .. 601 (119 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01012279.1 1171 .. 1289 (119 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement