ncbi logo
UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:20237 Links
AL009667
Homo sapiens locus CHRM3
Macaca mulatta chromosome 1, locus CHRM3
Pan troglodytes chromosome 1, locus CHRM3
Pongo abelii chromosome 1

Found by e-PCR in sequences from Homo sapiens, Macaca mulatta, Pan troglodytes, Papio anubis and Pongo abelii.

Primer InformationHelp

Forward primer:ATGTGCTGCAAACCACTCTG
Reverse primer:GAGGGTCGGAGACCAGGT
PCR product size:151 (bp), Homo sapiens
GenBank Accession:AL009667

   Homo sapiens
Name: AL009667
Also known as: stSG32513FS
Polymorphism info:  

Cross References Help
Gene GeneID:1131
 Symbol:CHRM3
 Description:cholinergic receptor, muscarinic 3
 Position:1q43


Electronic PCR results Help
Genomic RefSeqs (5 of 7)[Show All Hits]
NW_001838549.1 9421285 .. 9421435 (151 bp)  
AC_000133.1 210377715 .. 210377865 (151 bp)  
NT_167186.1 33436721 .. 33436871 (151 bp)  
NC_000001.10 239918942 .. 239919092 (151 bp)  
NG_032046.1 131570 .. 131720 (151 bp)  
 
Genomic (5 of 16)[Show All Hits]
AL009667.1 6 .. 156 (151 bp)  
AC104460.2 138198 .. 138348 (151 bp)  
CH003448.1 212734649 .. 212734799 (151 bp)  
CH003496.1 214713268 .. 214713418 (151 bp)  
CH471098.1 15755560 .. 15755710 (151 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (2)
AC011141.3 131407 .. 131557 (151 bp)  
AC013517.5 184524 .. 184674 (151 bp)  
 
ESTs (1)
BE092161.1 167 .. 317 (151 bp)  
 

   Macaca mulatta
Name: AL009667
Polymorphism info:  

Cross References Help
Gene GeneID:708901
 Symbol:CHRM3
 Description:cholinergic receptor, muscarinic 3
 Position: 

Mapping InformationHelp
AL009667 Sequence Map: Chr 1|Mmul_051212-Primary_Assembly Map Viewer
  Position: 217298645-217298792 (bp)

Electronic PCR results Help
Genomic RefSeqs (2)
NW_001109259.1 7137788 .. 7137935 (148 bp)  
NC_007858.1 217298645 .. 217298792 (148 bp)  
 

   Nomascus leucogenys
Name: AL009667
Polymorphism info:  
Mapping InformationHelp
AL009667 Sequence Map: Chr Un|NW_003501417.1|Nleu1.0-Primary_Assembly Map Viewer
  Position: 9257841-9257991 (bp)

   Pan troglodytes
Name: AL009667
Polymorphism info:  

Cross References Help
Gene GeneID:469725
 Symbol:CHRM3
 Description:cholinergic receptor, muscarinic 3
 Position: 

Mapping InformationHelp
AL009667 Sequence Map: Chr 1|Pan_troglodytes-2.1.4-Primary_Assembly Map Viewer
  Position: 219068428-219068578 (bp)

Electronic PCR results Help
Genomic RefSeqs (2)
NW_003456664.1 4715241 .. 4715391 (151 bp)  
NC_006468.3 219068428 .. 219068578 (151 bp)  
 

   Papio anubis
 
Polymorphism info:  

Electronic PCR results Help
Genomic RefSeqs (2)
NW_003871769.1 414022 .. 414172 (151 bp)  
NC_018152.1 209369334 .. 209369484 (151 bp)  
 
Genomic (2)
JH670919.1 414022 .. 414172 (151 bp)  
CM001491.1 209369334 .. 209369484 (151 bp)  
 

   Pongo abelii
Name: AL009667
Polymorphism info:  
Mapping InformationHelp
AL009667 Sequence Map: Chr 1|P_pygmaeus_2.0.2-Primary_Assembly Map Viewer
  Position: 9585012-9585162 (bp)

Electronic PCR results Help
Genomic RefSeqs (2)
NW_002874675.1 942201 .. 942351 (151 bp)  
NC_012591.1 9585012 .. 9585162 (151 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement