PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:20237 Links AL009667 Homo sapiens locus CHRM3 Macaca mulatta chromosome 1, locus CHRM3 Pan troglodytes chromosome 1, locus CHRM3 Pongo abelii chromosome 1 Found by e-PCR in sequences from Homo sapiens, Macaca mulatta, Pan troglodytes, Papio anubis and Pongo abelii. Primer Information Forward primer: ATGTGCTGCAAACCACTCTG Reverse primer: GAGGGTCGGAGACCAGGT PCR product size: 151 (bp), Homo sapiens GenBank Accession: AL009667    Homo sapiens Name: AL009667 Also known as: stSG32513FS Polymorphism info:   Cross References Gene GeneID: 1131   Symbol: CHRM3   Description: cholinergic receptor, muscarinic 3   Position: 1q43 Electronic PCR results Genomic RefSeqs (5 of 7)[Show All Hits] NW_001838549.1 9421285 .. 9421435 (151 bp)   AC_000133.1 210377715 .. 210377865 (151 bp)   NT_167186.1 33436721 .. 33436871 (151 bp)   NC_000001.10 239918942 .. 239919092 (151 bp)   NG_032046.1 131570 .. 131720 (151 bp)     Genomic (5 of 16)[Show All Hits] AL009667.1 6 .. 156 (151 bp)   AC104460.2 138198 .. 138348 (151 bp)   CH003448.1 212734649 .. 212734799 (151 bp)   CH003496.1 214713268 .. 214713418 (151 bp)   CH471098.1 15755560 .. 15755710 (151 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AC011141.3 131407 .. 131557 (151 bp)   AC013517.5 184524 .. 184674 (151 bp)     ESTs (1) BE092161.1 167 .. 317 (151 bp)        Macaca mulatta Name: AL009667 Polymorphism info:   Cross References Gene GeneID: 708901   Symbol: CHRM3   Description: cholinergic receptor, muscarinic 3   Position:   Mapping Information AL009667 Sequence Map: Chr 1|Mmul_051212-Primary_Assembly Map Viewer   Position: 217298645-217298792 (bp) Electronic PCR results Genomic RefSeqs (2) NW_001109259.1 7137788 .. 7137935 (148 bp)   NC_007858.1 217298645 .. 217298792 (148 bp)        Nomascus leucogenys Name: AL009667 Polymorphism info:   Mapping Information AL009667 Sequence Map: Chr Un|NW_003501417.1|Nleu1.0-Primary_Assembly Map Viewer   Position: 9257841-9257991 (bp)    Pan troglodytes Name: AL009667 Polymorphism info:   Cross References Gene GeneID: 469725   Symbol: CHRM3   Description: cholinergic receptor, muscarinic 3   Position:   Mapping Information AL009667 Sequence Map: Chr 1|Pan_troglodytes-2.1.4-Primary_Assembly Map Viewer   Position: 219068428-219068578 (bp) Electronic PCR results Genomic RefSeqs (2) NW_003456664.1 4715241 .. 4715391 (151 bp)   NC_006468.3 219068428 .. 219068578 (151 bp)        Papio anubis   Polymorphism info:   Electronic PCR results Genomic RefSeqs (2) NW_003871769.1 414022 .. 414172 (151 bp)   NC_018152.1 209369334 .. 209369484 (151 bp)     Genomic (2) JH670919.1 414022 .. 414172 (151 bp)   CM001491.1 209369334 .. 209369484 (151 bp)        Pongo abelii Name: AL009667 Polymorphism info:   Mapping Information AL009667 Sequence Map: Chr 1|P_pygmaeus_2.0.2-Primary_Assembly Map Viewer   Position: 9585012-9585162 (bp) Electronic PCR results Genomic RefSeqs (2) NW_002874675.1 942201 .. 942351 (151 bp)   NC_012591.1 9585012 .. 9585162 (151 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement