PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:18962 Links RH17820 Homo sapiens chromosome 11, locus TCP11L1 Macaca mulatta locus LOC694899 Pan troglodytes chromosome 11, locus TCP11L1 Found by e-PCR in sequences from Homo sapiens, Macaca fascicularis, Macaca mulatta, Pan troglodytes and Pongo abelii. Primer Information Forward primer: ATCTTACTCAGGATTGCATCG Reverse primer: TCATCAGAAGCCATTGCC PCR product size: 144 (bp), Homo sapiens GenBank Accession: R51067    Homo sapiens Name: RH17820 Also known as: R51067 Polymorphism info:   Cross References Gene GeneID: 55346   Symbol: TCP11L1   Description: t-complex 11 (mouse)-like 1   Position: 11p13 UniGene Hs.655341 T-complex 11 (mouse)-like 1 Mapping Information RH17820 Sequence Map: Chr 11|HuRef Map Viewer   Position: 32788736-32788879 (bp)   RH17820 Sequence Map: Chr 11 Map Viewer   Position: 33094063-33094206 (bp)   RH17820 Sequence Map: Chr 11|Celera Map Viewer   Position: 33240763-33240906 (bp)   R51067 NCBI RH Map: Chr 11 Map Viewer   Position: 235.4 (cR)   Lod score: 1.72   R51067 GeneMap99-GB4 Map: Chr 11 Map Viewer   Position: 125.99 (cR3000)   Lod score: 1.09   Reference Interval: D11S914-D11S907 Electronic PCR results RefSeq mRNA (2) NM_001145541.1 1587 .. 1730 (144 bp)   NM_018393.3 1771 .. 1914 (144 bp)     mRNA (3) AK002198.1 1569 .. 1712 (144 bp)   AK090646.1 1754 .. 1897 (144 bp)   BC041696.1 1590 .. 1733 (144 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_925006.1 28741087 .. 28741230 (144 bp)   AC_000054.1 33240763 .. 33240906 (144 bp)   AC_000143.1 32788736 .. 32788879 (144 bp)   NW_001838022.2 17827163 .. 17827306 (144 bp)   NT_009237.18 33034063 .. 33034206 (144 bp)     Genomic (3) AL121926.24 70313 .. 70456 (144 bp)   AC131263.6 135303 .. 135446 (144 bp)   AY413322.1 1371 .. 1514 (144 bp)     Low-pass Sequence Sampling (from GenBank HTGS division) (2) AC087716.1 26039 .. 26182 (144 bp)   AC087716.1 32511 .. 32654 (144 bp)     ESTs (5 of 10)[Show All Hits] T27081.1 185 .. 328 (144 bp)   R51067.1 195 .. 338 (144 bp)   R41697.1 196 .. 346 (151 bp)   W81641.1 131 .. 274 (144 bp)   AA569320.1 137 .. 280 (144 bp)     Whole Genome Shotgun sequences (5) AADD01114363.1 719 .. 862 (144 bp)   AADC01097258.1 526432 .. 526575 (144 bp)   AADB02013801.1 575690 .. 575833 (144 bp)   ABBA01060898.1 146420 .. 146563 (144 bp)   ABSL01074064.1 146421 .. 146564 (144 bp)     Patent sequences (5) BD155073.1 189 .. 332 (144 bp)   BD157170.1 1569 .. 1712 (144 bp)   AX875011.1 189 .. 332 (144 bp)   AX878356.1 1569 .. 1712 (144 bp)   CQ722860.1 1371 .. 1514 (144 bp)     High Thoughput cDNA sequences (1) BC030582.1 3067 .. 3210 (144 bp)        Macaca fascicularis   Polymorphism info:   Cross References UniGene Mfa.12534 Brain cDNA clone: QflA-16145, similar to human hypothetical protein FLJ11336... Electronic PCR results mRNA (1) AB171974.1 1603 .. 1747 (145 bp)        Macaca mulatta   Polymorphism info:   Cross References Gene GeneID: 694899   Symbol: LOC694899   Description: similar to CG16721-PA   Position:   Electronic PCR results RefSeq mRNA (1) XM_001083552.1 1476 .. 1620 (145 bp)        Pan troglodytes Name: RH17820 Polymorphism info:   Cross References Gene GeneID: 466483   Symbol: TCP11L1   Description: t-complex 11 (mouse)-like 1   Position:   Mapping Information RH17820 Sequence Map: Chr 11 Map Viewer   Position: 33308237-33308380 (bp) Electronic PCR results RefSeq mRNA (1) XM_521882.2 1371 .. 1514 (144 bp)     Genomic RefSeqs (1) NW_001222276.1 2875905 .. 2876048 (144 bp)     Genomic (1) AY413323.1 1371 .. 1514 (144 bp)     Whole Genome Shotgun sequences (2) AADA01359733.1 50653 .. 50796 (144 bp)   AACZ02123700.1 135082 .. 135225 (144 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01362631.1 6141 .. 6284 (144 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement