PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:18112 Links G20811 Homo sapiens chromosome 1, locus ADIPOR1 Pan troglodytes chromosome 1, locus ADIPOR1 Found by e-PCR in sequences from Homo sapiens, Oryctolagus cuniculus, Pan troglodytes and Pongo abelii. Primer Information Forward primer: ATCAAGATACATAGCAATGATAG Reverse primer: TTATAGAGCAGGAAGAATAAAG PCR product size: 200 (bp), Homo sapiens GenBank Accession: G20811    Homo sapiens Name: G20811 Also known as: A006H25 Polymorphism info:   Cross References Gene GeneID: 51094   Symbol: ADIPOR1   Description: adiponectin receptor 1   Position: 1p36.13-q41 UniGene Hs.5298 Adiponectin receptor 1 Mapping Information G20811 Sequence Map: Chr 1|HuRef Map Viewer   Position: 174075669-174075867 (bp)   G20811 Sequence Map: Chr 1|Celera Map Viewer   Position: 176039260-176039458 (bp)   G20811 Sequence Map: Chr 1 Map Viewer   Position: 202910013-202910211 (bp) Electronic PCR results RefSeq mRNA (2) NM_015999.3 1885 .. 2083 (199 bp)   NM_001127687.1 1877 .. 2075 (199 bp)     mRNA (5) BC010743.1 1811 .. 2009 (199 bp)   AF125179.1 1792 .. 1990 (199 bp)   BC001594.2 1817 .. 2016 (200 bp)   AK124455.1 1852 .. 2049 (198 bp)   AK222503.1 1798 .. 1997 (200 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_926128.1 41294019 .. 41294217 (199 bp)   AC_000044.1 176039260 .. 176039458 (199 bp)   AC_000133.1 174075669 .. 174075867 (199 bp)   NW_001838533.2 3029384 .. 3029582 (199 bp)   NT_004487.19 54398655 .. 54398853 (199 bp)     Genomic (3) G20811.1 1 .. 200 (200 bp)   AC096632.3 50039 .. 50237 (199 bp)   BV178066.1 54 .. 251 (198 bp)     ESTs (5 of 195)[Show All Hits] D25572.1 8 .. 206 (199 bp)   R22023.1 39 .. 241 (203 bp)   R24167.1 17 .. 217 (201 bp)   R51880.1 49 .. 246 (198 bp)   R43514.1 63 .. 266 (204 bp)     Whole Genome Shotgun sequences (4) AADD01011842.1 14252 .. 14450 (199 bp)   AADB02001081.1 534822 .. 535020 (199 bp)   ABBA01027490.1 8011 .. 8209 (199 bp)   ABSL01055441.1 8011 .. 8209 (199 bp)     Patent sequences (5 of 10)[Show All Hits] AX083500.1 1866 .. 2065 (200 bp)   AX302721.1 58 .. 254 (197 bp)   BD205645.1 1312 .. 1511 (200 bp)   CS063694.1 1811 .. 2009 (199 bp)   BD396833.1 1866 .. 2065 (200 bp)     High Thoughput cDNA sequences (5 of 12)[Show All Hits] CR590124.1 1818 .. 2016 (199 bp)   CR593948.1 1806 .. 2004 (199 bp)   CR596678.1 1818 .. 2016 (199 bp)   CR597679.1 1863 .. 2061 (199 bp)   CR598544.1 883 .. 1081 (199 bp)        Oryctolagus cuniculus   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) AAGW02068136.1 4057 .. 4249 (193 bp)        Pan troglodytes Name: G20811 Polymorphism info:   Cross References Gene GeneID: 457635   Symbol: ADIPOR1   Description: adiponectin receptor 1   Position:   Mapping Information G20811 Sequence Map: Chr 1 Map Viewer   Position: 182999444-182999646 (bp) Electronic PCR results RefSeq mRNA (5 of 7)[Show All Hits] XM_001152270.1 1801 .. 2003 (203 bp)   XM_001152338.1 2237 .. 2439 (203 bp)   XM_001152393.1 1855 .. 2057 (203 bp)   XM_001152460.1 1877 .. 2079 (203 bp)   XM_001152528.1 1880 .. 2082 (203 bp)     Genomic RefSeqs (1) NW_001229611.1 6161643 .. 6161845 (203 bp)     Whole Genome Shotgun sequences (2) AADA01325655.1 3417 .. 3619 (203 bp)   AACZ02012267.1 14912 .. 15114 (203 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01056163.1 9571 .. 9771 (201 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement