PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:157321 Links GDB:451592 Homo sapiens loci KIAA0174 and LOC728533 Macaca mulatta chromosome 20;3, loci LOC718932, KIAA0174, and LOC707143 Pan troglodytes loci LOC745404 and LOC456001 Found by e-PCR in sequences from Homo sapiens, Macaca mulatta, Pan troglodytes, Papio anubis and Pongo abelii. Primer Information Forward primer: GGGTGGCTTTGGGATTGG Reverse primer: CAGCTACTGAGCTACAGAATAC PCR product size: 121 (bp), Homo sapiens    Homo sapiens Warning! This marker matched more than 2 locations on genome by e-PCR and therefore excluded from annotation. Name: GDB:451592 Also known as: D12F2651E Polymorphism info:   Cross References Gene GeneID: 728533   Symbol: LOC728533   Description: similar to CG10103   Position: 19q13.12 Gene GeneID: 9798   Symbol: KIAA0174   Description: KIAA0174   Position: 16q22.2 UniGene Hs.232194 KIAA0174   Hs.651115 Transcribed locus, strongly similar to NP_001017454.1 hypothetical protein L... Electronic PCR results RefSeq mRNA (4) NM_014761.2 2208 .. 2328 (121 bp)   XR_015610.3 1954 .. 2074 (121 bp)   XR_019503.3 1954 .. 2074 (121 bp)   XR_038917.2 1954 .. 2074 (121 bp)     mRNA (5 of 8)[Show All Hits] D79996.1 2207 .. 2327 (121 bp)   AL355695.1 1260 .. 1380 (121 bp)   BC000116.1 2109 .. 2229 (121 bp)   BC004359.1 2208 .. 2328 (121 bp)   AK057902.1 2225 .. 2345 (121 bp)     Genomic RefSeqs (5 of 18)[Show All Hits] NT_010498.15 25576964 .. 25577084 (121 bp)   NW_925395.1 3333967 .. 3334087 (121 bp)   NW_926517.1 768819 .. 768939 (121 bp)   NW_927217.1 491675 .. 491795 (121 bp)   AC_000055.1 55710138 .. 55710258 (121 bp)     Genomic (5) G06036.1 22 .. 142 (121 bp)   AC007676.19 124028 .. 124148 (121 bp)   AC009779.18 73192 .. 73312 (121 bp)   AC016582.9 55145 .. 55265 (121 bp)   AC009127.10 83402 .. 83522 (121 bp)     ESTs (5 of 201)[Show All Hits] T06627.1 19 .. 139 (121 bp)   Z28950.1 24 .. 144 (121 bp)   T17335.1 24 .. 144 (121 bp)   Z38301.1 22 .. 142 (121 bp)   T32093.1 22 .. 142 (121 bp)     Whole Genome Shotgun sequences (5 of 14)[Show All Hits] AADD01165228.1 15519 .. 15639 (121 bp)   AADD01149895.1 1206 .. 1326 (121 bp)   AADD01124344.1 7958 .. 8078 (121 bp)   AADC01139088.1 29755 .. 29875 (121 bp)   AADC01126848.1 15790 .. 15910 (121 bp)     Patent sequences (5 of 23)[Show All Hits] BD186186.1 2183 .. 2303 (121 bp)   BD186187.1 1413 .. 1533 (121 bp)   BD186188.1 2241 .. 2361 (121 bp)   BD190288.1 2207 .. 2327 (121 bp)   BD190290.1 1413 .. 1533 (121 bp)     High Thoughput cDNA sequences (3) CR592890.1 1514 .. 1634 (121 bp)   CR608887.1 1703 .. 1823 (121 bp)   BC006261.1 3020 .. 3140 (121 bp)        Macaca mulatta Name: GDB:451592 Polymorphism info:   Cross References Gene GeneID: 707143   Symbol: LOC707143   Description: similar to polycystic kidney disease 1 like 3   Position:   Gene GeneID: 707245   Symbol: KIAA0174   Description: KIAA0174   Position:   Gene GeneID: 718932   Symbol: LOC718932   Description: similar to putative MAPK activating protein PM28   Position:   UniGene Mmu.13031 KIAA0174 Mapping Information GDB:451592 Sequence Map: Chr 3 Map Viewer   Position: 46980293-46980409 (bp)   GDB:451592 Sequence Map: Chr 20 Map Viewer   Position: 70722503-70722619 (bp) Electronic PCR results RefSeq mRNA (5 of 7)[Show All Hits] XM_001112317.1 1413 .. 1529 (117 bp)   XM_001104896.1 1579 .. 1695 (117 bp)   XM_001105424.1 2249 .. 2365 (117 bp)   XM_001105348.1 2207 .. 2323 (117 bp)   XM_001105281.1 2156 .. 2272 (117 bp)     Genomic RefSeqs (2) NW_001114199.1 1030480 .. 1030596 (117 bp)   NW_001111354.1 6804169 .. 6804285 (117 bp)     Genomic (1) AC197751.3 168895 .. 169011 (117 bp)     ESTs (1) CB310489.1 28 .. 144 (117 bp)     Whole Genome Shotgun sequences (2) AANU01177709.1 15190 .. 15306 (117 bp)   AANU01101874.1 16245 .. 16361 (117 bp)        Pan troglodytes Warning! This marker matched more than 2 locations on genome by e-PCR and therefore excluded from annotation.   Polymorphism info:   Cross References Gene GeneID: 456001   Symbol: LOC456001   Description: similar to KIAA0174 protein   Position:   Gene GeneID: 745404   Symbol: LOC745404   Description: similar to KIAA0174   Position:   Electronic PCR results RefSeq mRNA (2) XM_001151193.1 2555 .. 2675 (121 bp)   XR_024948.1 2234 .. 2354 (121 bp)     Genomic RefSeqs (3) NW_001223153.1 12614879 .. 12614999 (121 bp)   NW_001226058.1 1771141 .. 1771261 (121 bp)   NW_001228224.1 2124537 .. 2124657 (121 bp)     Genomic (1) AC195070.2 126916 .. 127036 (121 bp)     Whole Genome Shotgun sequences (5 of 6)[Show All Hits] AADA01285054.1 2212 .. 2332 (121 bp)   AADA01153961.1 2694 .. 2814 (121 bp)   AADA01134282.1 6376 .. 6496 (121 bp)   AACZ02184936.1 6561 .. 6681 (121 bp)   AACZ02164143.1 2719 .. 2839 (121 bp)        Papio anubis   Polymorphism info:   Electronic PCR results Working Draft phase 2 (from GenBank HTGS division) (1) AC141417.16 68727 .. 68843 (117 bp)     ESTs (2) FC162159.1 5 .. 121 (117 bp)   GE899532.1 627 .. 742 (116 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results RefSeq mRNA (1) NM_001133078.1 2185 .. 2305 (121 bp)     Whole Genome Shotgun sequences (2) ABGA01136350.1 3014 .. 3132 (119 bp)   ABGA01043812.1 1737 .. 1857 (121 bp)     High Thoughput cDNA sequences (1) CR860522.1 2185 .. 2305 (121 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement