PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:15416 Links RH46837 Homo sapiens chromosome 6, loci FAM46A and LOC100134123 Pan troglodytes chromosome 6, locus LOC462847 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Pongo abelii. Primer Information Forward primer: AGGGTACTTCGCCATGTCTG Reverse primer: ATAGTCCAAGCAATGCCCAC PCR product size: 151 (bp), Homo sapiens    Homo sapiens Name: RH46837 Also known as: stSG24948 Polymorphism info:   Cross References Gene GeneID: 100134123   Symbol: LOC100134123   Description: hypothetical protein LOC100134123   Position:   Gene GeneID: 55603   Symbol: FAM46A   Description: family with sequence similarity 46, member A   Position: 6q14 UniGene Hs.10784 Family with sequence similarity 46, member A   Hs.702324 Transcribed locus, strongly similar to XP_001719410.1 PREDICTED: hypothetica... Mapping Information RH46837 Sequence Map: Chr 6|HuRef Map Viewer   Position: 79679180-79679345 (bp)   RH46837 Sequence Map: Chr 6 Map Viewer   Position: 82461694-82461844 (bp)   RH46837 Sequence Map: Chr 6|Celera Map Viewer   Position: 82884590-82884740 (bp)   stSG24948 GeneMap99-GB4 Map: Chr 6 Map Viewer   Position: 368.28 (cR3000)   Lod score: 3.00   Reference Interval: D6S445-D6S1644 Electronic PCR results RefSeq mRNA (2) NM_017633.2 333 .. 483 (151 bp)   XM_001719358.2 392 .. 526 (135 bp)     mRNA (5 of 9)[Show All Hits] AK000044.1 301 .. 466 (166 bp)   AK056057.1 385 .. 550 (166 bp)   AJ420592.1 153 .. 318 (166 bp)   AF350451.1 309 .. 444 (136 bp)   BC007351.2 317 .. 482 (166 bp)     Genomic RefSeqs (5 of 6)[Show All Hits] NW_923184.1 14953194 .. 14953344 (151 bp)   AC_000049.1 82884590 .. 82884740 (151 bp)   NW_001838987.1 11857382 .. 11857547 (166 bp)   AC_000138.1 79679180 .. 79679345 (166 bp)   NT_007299.13 20581528 .. 20581678 (151 bp)     Genomic (1) AL078599.19 57767 .. 57917 (151 bp)     ESTs (5 of 83)[Show All Hits] R26131.1 35 .. 183 (149 bp)   R67855.1 46 .. 196 (151 bp)   R68610.1 6 .. 156 (151 bp)   R69088.1 60 .. 194 (135 bp)   H13281.1 25 .. 174 (150 bp)     Whole Genome Shotgun sequences (5) AADD01071681.1 3772 .. 3937 (166 bp)   AADC01061472.1 86620 .. 86775 (156 bp)   AADB02010112.1 508185 .. 508335 (151 bp)   ABBA01040441.1 216352 .. 216517 (166 bp)   ABSL01063606.1 216352 .. 216517 (166 bp)     Patent sequences (5 of 7)[Show All Hits] AX511481.1 301 .. 466 (166 bp)   BD224086.1 279 .. 414 (136 bp)   AX809430.1 15 .. 180 (166 bp)   CS038310.1 301 .. 466 (166 bp)   DD131104.1 301 .. 466 (166 bp)        Pan troglodytes Name: RH46837 Polymorphism info:   Cross References Gene GeneID: 462847   Symbol: LOC462847   Description: similar to chromosome 6 open reading frame 37   Position:   Mapping Information RH46837 Sequence Map: Chr 6 Map Viewer   Position: 82852827-82853007 (bp) Electronic PCR results RefSeq mRNA (3) XM_518605.2 258 .. 438 (181 bp)   XM_001147967.1 290 .. 470 (181 bp)   XM_001148042.1 565 .. 745 (181 bp)     Genomic RefSeqs (1) NW_001236562.1 14313144 .. 14313324 (181 bp)     Whole Genome Shotgun sequences (2) AADA01233672.1 6214 .. 6379 (166 bp)   AACZ02073288.1 34015 .. 34195 (181 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01075888.1 13362 .. 13530 (169 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement