PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:148226 Links D3S1358 Homo sapiens chromosome 3, loci LARS2, LOC100294483, and LOC100291683 Pan troglodytes chromosome 3, locus LARS2 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Pongo abelii. Primer Information Forward primer: ACTGCAGTCCAATCTGGGT Reverse primer: ATGAAATCAACAGAGGCTTG PCR product size: 97 (bp), Homo sapiens    Homo sapiens Name: D3S1358 Also known as: GDB:196594 Polymorphism info:   Cross References Gene GeneID: 100291683   Symbol: LOC100291683   Description: hypothetical protein LOC100291683   Position:   Gene GeneID: 100294483   Symbol: LOC100294483   Description: hypothetical protein LOC100294483   Position:   Gene GeneID: 23395   Symbol: LARS2   Description: leucyl-tRNA synthetase 2, mitochondrial   Position: 3p21.3 Mapping Information D3S1358 Sequence Map: Chr 3|Celera Map Viewer   Position: 45520628-45520758 (bp)   D3S1358 Sequence Map: Chr 3 Map Viewer   Position: 45582205-45582335 (bp)   D3S1358 Sequence Map: Chr 3|HuRef Map Viewer   Position: 45626776-45626906 (bp) Electronic PCR results Genomic RefSeqs (5 of 6)[Show All Hits] NW_921651.1 45520628 .. 45520758 (131 bp)   AC_000046.1 45520628 .. 45520758 (131 bp)   AC_000135.1 45626776 .. 45626906 (131 bp)   NW_001838877.2 20640756 .. 20640886 (131 bp)   NT_022517.18 45522205 .. 45522335 (131 bp)     Genomic (2) AJ312685.1 11362 .. 11500 (139 bp)   AC099539.2 77721 .. 77851 (131 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AJ132411.1 7288 .. 7426 (139 bp)   AC012659.3 121351 .. 121481 (131 bp)     Whole Genome Shotgun sequences (5 of 6)[Show All Hits] AADD01032351.1 11294 .. 11424 (131 bp)   AADC01028683.1 10357 .. 10487 (131 bp)   AADB02344556.1 128 .. 258 (131 bp)   AADB02003493.1 96520 .. 96650 (131 bp)   ABBA01024725.1 52773 .. 52903 (131 bp)        Pan troglodytes Name: D3S1358 Polymorphism info:   Cross References Gene GeneID: 739246   Symbol: LARS2   Description: leucyl-tRNA synthetase 2, mitochondrial   Position:   Mapping Information D3S1358 Sequence Map: Chr 3 Map Viewer   Position: 46574061-46574187 (bp) Electronic PCR results Genomic RefSeqs (1) NW_001232822.1 895053 .. 895179 (127 bp)     Whole Genome Shotgun sequences (2) AADA01176454.1 27253 .. 27379 (127 bp)   AACZ02035715.1 4231 .. 4357 (127 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01071175.1 11545 .. 11668 (124 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement