PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:109443 Links G54061 Homo sapiens chromosome 7, locus SCRN1 Pan troglodytes chromosome 7, locus SCRN1 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Pongo abelii. Primer Information Forward primer: AAAGGAACCCCACAGCTAAG Reverse primer: CCTTTCATTCTTGGAGGTGC PCR product size: 166 (bp), Homo sapiens GenBank Accession: G54061    Homo sapiens Name: G54061 Also known as: 1813 Polymorphism info:   Cross References Gene GeneID: 9805   Symbol: SCRN1   Description: secernin 1   Position: 7p14.3-p14.1 UniGene Hs.520740 Secernin 1 Mapping Information G54061 Sequence Map: Chr 7|HuRef Map Viewer   Position: 29842126-29842291 (bp)   G54061 Sequence Map: Chr 7|Celera Map Viewer   Position: 29949830-29949995 (bp)   G54061 Sequence Map: Chr 7 Map Viewer   Position: 29960442-29960607 (bp)   G54061 Sequence Map: Chr 7|CRA_TCAGchr7v2 Map Viewer   Position: 30010265-30010430 (bp) Electronic PCR results RefSeq mRNA (4) NM_014766.4 4380 .. 4545 (166 bp)   NM_001145514.1 4320 .. 4485 (166 bp)   NM_001145515.1 4220 .. 4385 (166 bp)   NM_001145513.1 4388 .. 4553 (166 bp)     mRNA (3) D83777.2 4323 .. 4488 (166 bp)   BC040492.1 4332 .. 4497 (166 bp)   AB071705.1 4270 .. 4435 (166 bp)     Genomic RefSeqs (5 of 8)[Show All Hits] NW_923240.1 23120695 .. 23120860 (166 bp)   NT_079592.2 29960265 .. 29960430 (166 bp)   AC_000050.1 29949830 .. 29949995 (166 bp)   AC_000068.1 30010265 .. 30010430 (166 bp)   NW_001839003.1 23685351 .. 23685516 (166 bp)     Genomic (2) G54061.1 1 .. 166 (166 bp)   AC004912.2 116300 .. 116465 (166 bp)     ESTs (5 of 40)[Show All Hits] H97457.1 66 .. 231 (166 bp)   N42389.1 53 .. 218 (166 bp)   AA036818.1 240 .. 405 (166 bp)   AA169692.1 33 .. 198 (166 bp)   AA309827.1 229 .. 394 (166 bp)     Whole Genome Shotgun sequences (5 of 6)[Show All Hits] AADD01079720.1 35300 .. 35465 (166 bp)   AADC01067024.1 131995 .. 132160 (166 bp)   AACC02000087.1 2743974 .. 2744139 (166 bp)   AADB02010433.1 2155480 .. 2155645 (166 bp)   ABBA01056806.1 36522 .. 36687 (166 bp)     Patent sequences (5 of 10)[Show All Hits] AX329597.1 4359 .. 4524 (166 bp)   AX779891.1 4359 .. 4524 (166 bp)   AX961980.1 4270 .. 4435 (166 bp)   CQ726444.1 4357 .. 4522 (166 bp)   BD311700.1 1225 .. 1390 (166 bp)        Pan troglodytes Name: G54061 Polymorphism info:   Cross References Gene GeneID: 463323   Symbol: SCRN1   Description: secernin 1   Position:   Mapping Information G54061 Sequence Map: Chr 7 Map Viewer   Position: 30287963-30288128 (bp) Electronic PCR results RefSeq mRNA (1) XM_519021.2 4330 .. 4495 (166 bp)     Genomic RefSeqs (1) NW_001237933.1 23402777 .. 23402942 (166 bp)     Genomic (1) AC187736.3 167340 .. 167505 (166 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC146158.1 157280 .. 157445 (166 bp)     Working Draft phase 2 (from GenBank HTGS division) (2) AC091622.2 37705 .. 37870 (166 bp)   AC094110.2 116728 .. 116893 (166 bp)     Whole Genome Shotgun sequences (2) AADA01257094.1 4888 .. 5053 (166 bp)   AACZ02082051.1 71145 .. 71310 (166 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01275414.1 15323 .. 15494 (172 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement