PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:10361 Links SHGC-32584 Homo sapiens chromosome 6, locus LOC100130357 Pan troglodytes chromosome 6, locus PHACTR1 Found by e-PCR in sequences from Homo sapiens, Pan troglodytes and Pongo abelii. Primer Information Forward primer: ACTGAGCATATGACATCTTTCCC Reverse primer: CATTTCTGGGGGAGTCTGG PCR product size: 133 (bp), Homo sapiens GenBank Accession: G27600 H83427    Homo sapiens Name: SHGC-32584 Also known as: EST385727 SGC32584 Polymorphism info:   Cross References Gene GeneID: 100130357   Symbol: LOC100130357   Description: similar to hCG2038897   Position: 6p24.1 UniGene Hs.436996 Phosphatase and actin regulator 1 Mapping Information SHGC-32584 Sequence Map: Chr 6|HuRef Map Viewer   Position: 13224911-13225043 (bp)   SHGC-32584 Sequence Map: Chr 6 Map Viewer   Position: 13287915-13288047 (bp)   SHGC-32584 Sequence Map: Chr 6|Celera Map Viewer   Position: 14520888-14521020 (bp)   SHGC-32584 NCBI RH Map: Chr 6 Map Viewer   Position: 119.3 (cR)   Lod score: 1.73   SHGC-32584 TNG Map: Chr 6 Map Viewer   Position: 8696 (cR50000)   Lod score: 17.4   Reference Interval: 21   SHGC-32584 Stanford-G3 Map: Chr 6 Map Viewer   Position: 821 (cR10000)   Lod score: F   Reference Interval: 2   SGC32584 Whitehead-RH Map: Chr 6 Map Viewer   Position: 69.6 (cR3000)   Lod score: P0.01   SHGC-32584 GeneMap99-G3 Map: Chr 6 Map Viewer   Position: 953 (cR10000)   Lod score: F   Reference Interval: D6S1640-D6S422   SGC32584 GeneMap99-GB4 Map: Chr 6 Map Viewer   Position: 47.63 (cR3000)   Lod score: 0.41   Reference Interval: D6S1640-D6S422 Electronic PCR results Genomic RefSeqs (5 of 6)[Show All Hits] NW_922984.1 12916144 .. 12916276 (133 bp)   AC_000049.1 14520888 .. 14521020 (133 bp)   NW_001838973.1 9569948 .. 9570080 (133 bp)   AC_000138.1 13224911 .. 13225043 (133 bp)   NT_007592.15 13227915 .. 13228047 (133 bp)     Genomic (2) G27600.1 2 .. 134 (133 bp)   AL008729.1 110563 .. 110695 (133 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC051661.1 91124 .. 91256 (133 bp)     ESTs (5 of 12)[Show All Hits] H83427.1 2 .. 134 (133 bp)   H98750.1 23 .. 153 (131 bp)   H98916.1 23 .. 155 (133 bp)   AA713488.1 44 .. 175 (132 bp)   AA809685.1 44 .. 176 (133 bp)     Whole Genome Shotgun sequences (5 of 7)[Show All Hits] AADD01067227.1 17760 .. 17892 (133 bp)   AADC01058343.1 177825 .. 177957 (133 bp)   AADB02347253.1 184 .. 316 (133 bp)   AADB02186498.1 13 .. 145 (133 bp)   AADB02009968.1 549749 .. 549881 (133 bp)     Patent sequences (2) CQ861449.1 110563 .. 110695 (133 bp)   CQ919775.1 439 .. 571 (133 bp)        Pan troglodytes Name: SHGC-32584 Polymorphism info:   Cross References Gene GeneID: 462438   Symbol: PHACTR1   Description: phosphatase and actin regulator 1   Position:   Mapping Information SHGC-32584 Sequence Map: Chr 6 Map Viewer   Position: 13508647-13508779 (bp) Electronic PCR results Genomic RefSeqs (1) NW_001236512.1 9692518 .. 9692650 (133 bp)     Whole Genome Shotgun sequences (2) AADA01144651.1 2324 .. 2455 (132 bp)   AACZ02069220.1 34576 .. 34708 (133 bp)        Pongo abelii   Polymorphism info:   Electronic PCR results Whole Genome Shotgun sequences (1) ABGA01346201.1 23223 .. 23355 (133 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement