Probe Pr008816793.1-Gene AURKAIP1

Pr008816793.1	Links
Small hairpin RNA (shRNA) probe for Homo sapiens gene aurora kinase A interacting protein 1 (AURKAIP1). Developed for RNA interference (RNAi), validation succeeded.

Small hairpin RNA (shRNA)

SEQUENCE

>gnl|Probe|8816793a.1 shRNA probe , sense sequence (58 bp)

AGATGAACCACCACAAGTACCCTGTGCTGTCCGGTACTTG
TGGTGGTTCATCTTTTTT

Position			Feature
1	..	21	sense sequence
33	..	53	antisense sequence for NM_017900

REFERENCES

Sudo H, et al. A loss of function screen identifies nine new radiation susceptibility genes. Biochem Biophys Res Commun. 2007 Dec;364(3):695-701.

SUBMISSION DETAILS

Created On: 08-Nov-2007

Sequence Updated On: 09-Nov-2007

Annotation Updated On: 09-Nov-2007

Probe design is based on Homo sapiens AURKAIP1 sequences NM_017900.1, NM_017900.1.

Prepared by NCBI staff from published data (Sudo H et al, 2007) .

Validation Status: Passed

Probes for gene AURKAIP1 (Primary_Assembly assembly, build 37)

The current probe (Pr008816793.1) is in red.

Probe	Name	Type	%ID	Notes¹
Pr144033.1	V2HS_174402	shRNA	100	G
Pr008676080.1	TRCN0000037579	shRNA	100	G
Pr008676081.1	TRCN0000037580	shRNA	100	G
Pr008676082.1	TRCN0000037581	shRNA	100	G
Pr008676083.1	TRCN0000037582	shRNA	100	G
Pr008676084.1	TRCN0000037583	shRNA	100	G
Pr008816793.1	--	shRNA	100	GV

1.	Notes
	G = Probes designed for this gene (7 probes)
	V = Validated experimentally (1 probes)
	g = Probes designed for other genes/organisms (3 probes)