Probe Pr008810001.1-Gene BAD

Pr008810001.1	Links
Small interfering RNA (siRNA) probe for Homo sapiens gene BCL2-associated agonist of cell death (BAD). Developed for RNA interference (RNAi). Reagent is available from Qiagen.

Small interfering RNA (siRNA)

SEQUENCE

>gnl|Probe|8810001a.1 siRNA probe , sense strand (21 bp)

GAGTTTGTGGACTCCTTTATT

Position			Feature
1	..	19	sense strand
20	..	21	siRNA overhang (dna)

>gnl|Probe|8810001b.1 siRNA probe , antisense strand (21 bp)

TAAAGGAGTCCACAAACTCGT

Position			Feature
1	..	19	antisense strand for NM_004322
20	..	21	siRNA overhang (dna)

REFERENCES

Martin SE, et al. Multiplexing siRNAs to compress RNAi-based screen size in human cells. Nucleic Acids Res. 2007 ;35(8):E57.

DISTRIBUTOR

SUBMISSION DETAILS

Created On: 24-Oct-2007

Sequence Updated On: 25-Oct-2007

Annotation Updated On: 26-Oct-2007

Probe design is based on Homo sapiens BAD sequences NM_004322.2, NM_004322.2.

Submitted by Natasha J. Caplen.
Prepared by NCBI staff from published data (Martin SE et al, 2007) .

Probes for gene BAD (Primary_Assembly assembly, build 37)

The current probe (Pr008810001.1) is in red.

Probe	Name	Type	%ID	Notes¹
Pr006104541.1	--	siRNA	100	GV
Pr008810001.1	--	siRNA	100	G
Pr008810002.1	--	siRNA	100	G
Pr008810003.1	--	siRNA	100	G
Pr120479.1	--	shRNA	100	GV
Pr151936.1	V2HS_202976	shRNA	100	G
Pr165451.1	V2HS_15289	shRNA	100	G
Pr006067078.1	V2HS_262043	shRNA	100	G
Pr006068286.1	V2HS_243025	shRNA	100	G
Pr006068422.1	V2HS_201511	shRNA	100	G
Pr008672585.1	TRCN0000033454	shRNA	100	G
Pr008672586.1	TRCN0000033455	shRNA	100	G
Pr008672587.1	TRCN0000033456	shRNA	100	G
Pr008672588.1	TRCN0000033457	shRNA	100	G
Pr008672589.1	TRCN0000033458	shRNA	100	G

1.	Notes
	G = Probes designed for this gene (15 probes)
	V = Validated experimentally (2 probes)
	g = Probes designed for other genes/organisms (2 probes)