Probe Pr008809996.1-Gene ASNS

Pr008809996.1	Links
Small interfering RNA (siRNA) probe for Homo sapiens gene asparagine synthetase (ASNS). Developed for RNA interference (RNAi). Reagent is available from Qiagen.

Small interfering RNA (siRNA)

SEQUENCE

>gnl|Probe|8809996a.1 siRNA probe , sense strand (21 bp)

GAAGCTAAAGGTCTTGTTATT

Position			Feature
1	..	19	sense strand
20	..	21	siRNA overhang (dna)

>gnl|Probe|8809996b.1 siRNA probe , antisense strand (21 bp)

TAACAAGACCTTTAGCTTCTG

Position			Feature
1	..	19	antisense strand for NM_001673
20	..	21	siRNA overhang (dna)

REFERENCES

Martin SE, et al. Multiplexing siRNAs to compress RNAi-based screen size in human cells. Nucleic Acids Res. 2007 ;35(8):E57.

DISTRIBUTOR

SUBMISSION DETAILS

Created On: 24-Oct-2007

Sequence Updated On: 25-Oct-2007

Annotation Updated On: 26-Oct-2007

Probe design is based on Homo sapiens ASNS sequences NM_001673.2, NM_001673.2.

Submitted by Natasha J. Caplen.
Prepared by NCBI staff from published data (Martin SE et al, 2007) .

Probes for gene ASNS (Primary_Assembly assembly, build 37)

The current probe (Pr008809996.1) is in red.

Probe	Name	Type	%ID	Notes¹
Pr008640242.1	--	siRNA	100	GV
Pr008640243.1	--	siRNA	100	GV
Pr008809995.1	--	siRNA	100	G
Pr008809996.1	--	siRNA	100	G
Pr133625.1	V2HS_132748	shRNA	100	G
Pr168303.1	V2HS_132750	shRNA	100	G
Pr006476074.1	Hs00155888_m1	TaqMan	n/a	G
Pr006490653.1	Hs00370265_m1	TaqMan	n/a	G
Pr006618307.1	Hs01682613_g1	TaqMan	n/a	G
Pr008686070.1	TRCN0000045873	shRNA	100	G
Pr008686071.1	TRCN0000045874	shRNA	100	G
Pr008686072.1	TRCN0000045875	shRNA	100	G
Pr008686073.1	TRCN0000045876	shRNA	100	G
Pr008686074.1	TRCN0000045877	shRNA	100	G

1.	Notes
	G = Probes designed for this gene (14 probes)
	V = Validated experimentally (3 probes)
	g = Probes designed for other genes/organisms (20 probes)