PubMedEntrezHuman GenomeGenBankMap ViewerBLAST
Search

Pr008809992.1 Links

Small interfering RNA (siRNA) probe for Homo sapiens gene Rho GDP dissociation inhibitor (GDI) beta (ARHGDIB). Developed for RNA interference (RNAi). Reagent is available from Qiagen.

 

Small interfering RNA (siRNA)

» More about RNAi

SEQUENCE

>gnl|Probe|8809992a.1 siRNA probe , sense strand (21 bp)
CAGCTGGGTCCCTCTTCAATT
Position Feature
1 .. 19 sense strand 
20 .. 21 siRNA overhang (dna)


>gnl|Probe|8809992b.1 siRNA probe , antisense strand (21 bp)
TTGAAGAGGGACCCAGCTGTG
Position Feature
1 .. 19 antisense strand for NM_001175
20 .. 21 siRNA overhang (dna)



REFERENCES

Martin SE, et al.  Multiplexing siRNAs to compress RNAi-based screen size in human cells. Nucleic Acids Res. 2007 ;35(8):E57.


DISTRIBUTOR

Qiagen
» Qiagen - Sample and Assay Technologies

SUBMISSION DETAILS

Created On: 24-Oct-2007

Sequence Updated On: 25-Oct-2007

Annotation Updated On: 26-Oct-2007

Probe design is based on Homo sapiens ARHGDIB sequence NM_001175.4.

Submitted by Natasha J. Caplen.
Prepared by NCBI staff from published data (Martin SE et al, 2007) .

  • ARHGDIB
Probes for gene ARHGDIB (Primary_Assembly assembly, build 37)
The current probe (Pr008809992.1) is in red.


Probe Name Type %ID Notes1
Pr008809991.1 -- siRNA 100 G
Pr008809992.1 -- siRNA 100 G
Pr172553.1 V2HS_94623 shRNA 100 G
Pr006070443.1 V2HS_94627 shRNA 100 G
Pr006477246.1 Hs00171288_m1 TaqMan n/a G
Pr006639219.1 Hs00929892_m1 TaqMan n/a G
Pr006639220.1 Hs00929893_m1 TaqMan n/a G
Pr006639221.1 Hs00929895_m1 TaqMan n/a G
Pr006639222.1 Hs00929896_m1 TaqMan n/a G
Pr008687325.1 TRCN0000047413 shRNA 100 G
Pr008687326.1 TRCN0000047414 shRNA 100 G
Pr008687327.1 TRCN0000047415 shRNA 100 G
Pr008687328.1 TRCN0000047416 shRNA 100 G
Pr008687329.1 TRCN0000047417 shRNA 100 G
1. Notes
  G = Probes designed for this gene (14 probes)
  L = Low-complexity sequences with amplicon (1 probes)
  V = Validated experimentally (3 probes)
  g = Probes designed for other genes/organisms (11 probes)


| E-mail Service Desk | Disclaimer | Privacy statement | Accessibility |
NCBI HomeNCBI SearchNCBI SiteMapProbe HomeProbe Help