Probe Pr008809987.1-Gene ARD1A

Pr008809987.1	Links
Small interfering RNA (siRNA) probe for Homo sapiens gene alpha-N-acetyltransferase 1A (ARD1A). Developed for RNA interference (RNAi). Reagent is available from Qiagen.

Small interfering RNA (siRNA)

SEQUENCE

>gnl|Probe|8809987a.1 siRNA probe , sense strand (21 bp)

AGATGAAATACTACTTCTATT

Position			Feature
1	..	19	sense strand
20	..	21	siRNA overhang (dna)

>gnl|Probe|8809987b.1 siRNA probe , antisense strand (21 bp)

TAGAAGTAGTATTTCATCTGG

Position			Feature
1	..	19	antisense strand for NM_003491
20	..	21	siRNA overhang (dna)

REFERENCES

Martin SE, et al. Multiplexing siRNAs to compress RNAi-based screen size in human cells. Nucleic Acids Res. 2007 ;35(8):E57.

DISTRIBUTOR

SUBMISSION DETAILS

Created On: 24-Oct-2007

Sequence Updated On: 25-Oct-2007

Annotation Updated On: 26-Oct-2007

Probe design is based on Homo sapiens ARD1A sequence NM_003491.2.

Submitted by Natasha J. Caplen.
Prepared by NCBI staff from published data (Martin SE et al, 2007) .

Probes for gene ARD1A (Primary_Assembly assembly, build 37)

The current probe (Pr008809987.1) is in red.

Probe	Name	Type	%ID	Notes¹
Pr003104471.1	--	siRNA	100	GV
Pr008809987.1	--	siRNA	100	G
Pr008809988.1	--	siRNA	100	G
Pr166142.1	V2HS_219865	shRNA	100	G
Pr168435.1	V2HS_172515	shRNA	100	G
Pr006478559.1	Hs00185854_m1	TaqMan	n/a	G
Pr006568186.1	Hs01125831_g1	TaqMan	n/a	G
Pr008674275.1	TRCN0000035414	shRNA	100	G
Pr008674276.1	TRCN0000035415	shRNA	100	G
Pr008674277.1	TRCN0000035416	shRNA	100	G
Pr008674278.1	TRCN0000035417	shRNA	100	G
Pr008674279.1	TRCN0000035418	shRNA	100	G

1.	Notes
	G = Probes designed for this gene (12 probes)
	V = Validated experimentally (1 probes)
	g = Probes designed for other genes/organisms (8 probes)