Probe Pr008809983.1-Gene ANP32A

Pr008809983.1	Links
Small interfering RNA (siRNA) probe for Homo sapiens gene acidic (leucine-rich) nuclear phosphoprotein 32 family, member A (ANP32A). Developed for RNA interference (RNAi). Reagent is available from Qiagen.

Small interfering RNA (siRNA)

SEQUENCE

>gnl|Probe|8809983a.1 siRNA probe , sense strand (21 bp)

GACTAAGTGGAATAACCTATT

Position			Feature
1	..	19	sense strand
20	..	21	siRNA overhang (dna)

>gnl|Probe|8809983b.1 siRNA probe , antisense strand (21 bp)

TAGGTTATTCCACTTAGTCAT

Position			Feature
1	..	19	antisense strand for NM_006305
20	..	21	siRNA overhang (dna)

REFERENCES

Martin SE, et al. Multiplexing siRNAs to compress RNAi-based screen size in human cells. Nucleic Acids Res. 2007 ;35(8):E57.

DISTRIBUTOR

SUBMISSION DETAILS

Created On: 24-Oct-2007

Sequence Updated On: 25-Oct-2007

Annotation Updated On: 26-Oct-2007

Probe design is based on Homo sapiens ANP32A sequences NM_006305.2, NM_006305.2.

Submitted by Natasha J. Caplen.
Prepared by NCBI staff from published data (Martin SE et al, 2007) .

Probes for gene ANP32A (Primary_Assembly assembly, build 37)

The current probe (Pr008809983.1) is in red.

Probe	Name	Type	%ID	Notes¹
Pr120012.1	--	siRNA	100	GV
Pr008809983.1	--	siRNA	100	G
Pr008809984.1	--	siRNA	100	G
Pr008648997.1	TRCN0000006902	shRNA	100	G
Pr008648998.1	TRCN0000006903	shRNA	100	G
Pr008648999.1	TRCN0000006904	shRNA	100	G
Pr008649000.1	TRCN0000006905	shRNA	100	G
Pr008649001.1	TRCN0000006906	shRNA	100	G

1.	Notes
	G = Probes designed for this gene (8 probes)
	L = Low-complexity sequences with amplicon (1 probes)
	V = Validated experimentally (3 probes)
	g = Probes designed for other genes/organisms (30 probes)