Display Settings:

Format

Send to:

Choose Destination

mir-58 ncRNA [ Caenorhabditis elegans ]

Gene ID: 260181, updated on 22-Dec-2012
Gene symbol
mir-58
Gene description
ncRNA
Locus tag
CELE_Y67D8A.4
Gene type
ncRNA
Organism
Caenorhabditis elegans (old-lineage: Eukaryota; Metazoa; Nematoda; Chromadorea; Rhabditida; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis)
Lineage
Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida; Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis
See mir-58 in MapViewer
Location:
chromosome: IV
Exon count:
1
Sequence:
Chromosome: IV; NC_003282.7 (3233251..3233347)

Chromosome IV - NC_003282.7Genomic Context describing neighboring genes Neighboring gene Protein M4.1 Neighboring gene Protein Y67D8A.2 Neighboring gene ncRNA Neighboring gene ncRNA Neighboring gene ncRNA Neighboring gene Protein DMD-9

Related articles in PubMed

GeneRIFs: Gene References Into FunctionsWhat's a GeneRIF?

Expression pattern

  • This gene is expressed at high level at all stages of development, embryos, L1, L2, L3, L4 larvae and aduts\; it is expressed at least in the soma, since the transcript is also found in large amounts in germ-line defective glp-4 animals [reviewed by Bartel D, Lau N, Lim L, oct 2003]

Molecular properties

  • [Ambros et al, RNA 2003] MicroRNAs (miRNAs) are small noncoding RNA gene products 20 to 25 nt long that are processed by Dicer (with 5'-phosphate and 3'-hydroxyl) from single stranded precursors with a characteristic hairpin secondary structure. They cannot reliably be distinguished from other RNAs such as small interfering RNAs also processed by Dicer, through their function or structure, but they can through a combination of expression properties: a distinct ~22-nt RNA transcript should be detectable by hybridization to a size-fractionated RNA sample\; biogenesis : MicroRNAs come from a single-molecule fold-back (hairpin) structure, not a hybrid between two antiparallel transcripts, and finally, in organisms with reduced Dicer function, increased precursor accumulation should occur. In the best cases, phylogenetic conservation of the ~22-nt miRNA sequence and its predicted fold-back precursor secondary structure is observed across distant species.
  • [Wormbase] mir-58 encodes a microRNA, a small non-protein coding RNA and is conserved in C. briggsae\; mir-58 is expressed constitutively throughout development in normal worms and in glp-4(bn2) adults\; many of the known microRNAs are involved in post-transcriptional regulation of genes\; the precise function of mir-58 is not known.
  • [This gene is annotated in collaboration with Nelson Lau and David Bartel] The mature miRNA sequence UGAGAUCGUUCAGUACGGCAAU originates from the 3' end of the stem-loop sequence GCTCGTCATATCCATTGCCCTACTCTTCGCATCTCATCACTTCGTCCAATACCATAGGGATGAGATCGTTCAGTACGGCAATGGACTGAGCTAGAGT. The actual transcript is not known. The miRNA stem-loop sequence displayed corresponds to the foldback structure used to find and define the miRNAs and their homologs in other species. This miRNA is exactly conserved in C. briggsae (100\% identity).

Genome Annotation

The following sections contain reference sequences that belong to a specific genome build. Explain

Reference assembly

Genomic

  1. NC_003282.7 

    Range
    3233251..3233347
    Download
    GenBank, FASTA, Sequence Viewer (Graphics)

RNA

  1. NR_000454.2 RNA Sequence

    Status: REVIEWED

  2. NR_053031.1 RNA Sequence

    Status: REVIEWED