U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

ACLA_025500 uncharacterized protein [ Aspergillus clavatus NRRL 1 ]

Gene ID: 4701651, updated on 14-Nov-2023

Summary

Go to the top of the page Help
Gene symbol
ACLA_025500
Gene description
uncharacterized protein
Locus tag
ACLA_025500
Gene type
protein coding
RefSeq status
PROVISIONAL
Organism
Aspergillus clavatus NRRL 1 (strain: NRRL 1, type-material: culture from type material of Aspergillus clavatus)
Lineage
Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae; Aspergillus; Aspergillus subgen. Fumigati
NEW
Try the new Gene table
Try the new Transcript table

Genomic context

Go to the top of the page Help
Location:
chromosome: Unknown
Exon count:
5

NW_001517094.1Genomic Context describing neighboring genes Neighboring gene HMG box protein Neighboring gene reverse transcriptase, RNaseH, putative Neighboring gene mitochondrial carrier protein, putative Neighboring gene eukaryotic translation initiation factor 3 subunit EifCh, putative

Genomic regions, transcripts, and products

Go to the top of the page Help
Genomic Sequence:
NW_001517094.1

Go to nucleotide: Graphics FASTA GenBank

Bibliography

Go to the top of the pageHelp

Related articles in PubMed

  1. Genomic islands in the pathogenic filamentous fungus Aspergillus fumigatus. Fedorova ND, et al. PLoS Genet, 2008 Apr 11. PMID 18404212, Free PMC Article

GeneRIFs: Gene References Into Functions

General gene information

Go to the top of the page Help

Homology

Repeated regions

  • Loc: 2208566-2208586 rpt_type = tandem , rpt_unit_seq = cca , satellite = microsatellite
  • Loc: 2208633-2208724 rpt_type = tandem , rpt_unit_seq = cgg , satellite = microsatellite
  • Loc: 2208780-2208866 rpt_type = tandem , rpt_unit_seq = gaaggaagaggaggaacgcaaagc , satellite = microsatellite
  • Loc: 2209975-2210083 rpt_type = tandem , rpt_unit_seq = cccgaa , satellite = microsatellite
  • Loc: 2210039-2210540 rpt_type = tandem , rpt_unit_seq = gaacccgaacccgaacctgagcctgagccggaacctgaaccaaaagcacctgcccttccagatgaccccctttataacaattgggcaaacctatcatccaaagaccggaagaagcgagaaaaatcactgatgaagaagggcctacctattcccggcaaggatatcataattcctgcggaacctgaacctgaacccgagccagtacccgaaccagaacctgttgttgaacct , satellite = microsatellite
  • Loc: 2210216-2210309 rpt_type = tandem , rpt_unit_seq = gaacct , satellite = microsatellite
  • Loc: 2210216-2210314 rpt_type = tandem , rpt_unit_seq = cccgaa , satellite = microsatellite
  • Loc: 2210216-2210981 rpt_type = tandem , rpt_unit_seq = gaacccgaacccgaacctgagcctgaacctgaaccggaacctgttgttgaacctgaacccgaacccgaacctgagcctgagccggaacctgaaccaaaagcacctgcccttccagatgaccccctttataacaattgggcaaacctatcatccaaagaccggaagaagcgagaaaaatcactgatgaagaagggcctacctattcccggcaaggatatcataattcctgcggaacctgaacctgaacccgagccagtacccgaaccagaacctgttgttgaacct , satellite = microsatellite
  • Loc: 2210447-2210594 rpt_type = tandem , rpt_unit_seq = gaacct , satellite = microsatellite
  • Loc: 2210447-2210599 rpt_type = tandem , rpt_unit_seq = cccgaa , satellite = microsatellite
  • Loc: 2210732-2210827 rpt_type = tandem , rpt_unit_seq = gaacct , satellite = microsatellite
  • Loc: 2210732-2210880 rpt_type = tandem , rpt_unit_seq = cccgaa , satellite = microsatellite
  • Loc: 2211044-2211158 rpt_type = tandem , rpt_unit_seq = ccagaacctgtcgttgaa , satellite = microsatellite
  • Loc: 2211155-2211632 rpt_type = tandem , rpt_unit_seq = gaaccagaaccggaaccggaagcacctgcctttccagatgaccctctctatgataattgggcaaatctatcatccaaagaccgtaagaggcgggaaaaatctctaatgaagaaaggccttcccattcccaataaggattatatgccatctgcagcacccgtgcctgaaccaatctctgagccagaacctattattgaaccagaaccagaaccagagccggagccagagccggagccagagcctgttatt , satellite = microsatellite
  • Loc: 2211365-2211395 rpt_type = tandem , rpt_unit_seq = ccagagccggag , satellite = microsatellite
  • Loc: 2211602-2211632 rpt_type = tandem , rpt_unit_seq = ccagag , satellite = microsatellite
  • Loc: 2211641-2211664 rpt_type = tandem , rpt_unit_seq = gaaccggaacca , satellite = microsatellite
  • Loc: 2212445-2212513 rpt_type = tandem , rpt_unit_seq = cctgaa , satellite = microsatellite
  • Loc: 2212445-2212542 rpt_type = tandem , rpt_unit_seq = cccgaa , satellite = microsatellite
  • Loc: 2212598-2212703 rpt_type = tandem , rpt_unit_seq = cccgaa , satellite = microsatellite
  • Loc: 2212756-2212871 rpt_type = tandem , rpt_unit_seq = cccgaa , satellite = microsatellite

General protein information

Go to the top of the page Help
Preferred Names
uncharacterized protein
XP_001269259.1
  • encoded by transcript ACLA_025500A
    predicted by EVM2

NCBI Reference Sequences (RefSeq)

Go to the top of the page Help

NEW Try the new Transcript table

Genome Annotation

The following sections contain reference sequences that belong to a specific genome build. Explain

Reference assembly

Genomic

  1. NW_001517094.1 Reference assembly

    Range
    2207925..2215101
    Download
    GenBank, FASTA, Sequence Viewer (Graphics)

mRNA and Protein(s)

  1. XM_001269258.1 → XP_001269259.1  uncharacterized protein ACLA_025500 [Aspergillus clavatus NRRL 1]

    See identical proteins and their annotated locations for XP_001269259.1

    Status: PROVISIONAL

    UniProtKB/TrEMBL
    A1CQB2
Nucleotide Protein
Heading Accession and Version

Gene LinkOut

The following LinkOut resources are supplied by external providers. These providers are responsible for maintaining the links.

Molecular Biology Databases