The following information provides the different methods to submit updates to GenBank
in order to ensure that your update is processed quickly and correctly. Updates provided in an incorrect format will delay processing. All update files should be saved as plain text.
Do not submit a new Sequin file to update an existing record. However, Sequin can be used in Network aware mode to download your publicly available records for update as described below.
Update files in the formats below should be emailed directly to gb-admin@ncbi.nlm.nih.gov or uploaded using
UpdateMacroSend
.
Editing Source Information |
Send updates to the source information (i.e. strain, cultivar, country, specimen_voucher) in a multi-column tab-delimited table, for example:
acc. num. strain country
AYxxxx02 82 USA
AYxxxx03 ABC Canada
|
Updating Publication Information |
Send updates for the publication information as text. Include the GenBank accession number(s) and all relevant publication
information. The author lists should be formatted as Last_Name(family name), First_Initial, Middle_Initial. The complete journal name should be included (not the abbreviation).
|
Nucleotide Sequence Update |
If you are updating the current nucleotide sequence send the complete new sequence(s) in fasta format:
>AYxxxx02
cggtaataatggaccttggaccccggcaaagcggagagac
>AYxxxx03
ggaccttggaccccggcaaagcggagagaccggtaataat
Please do not send a list of nucleotide changes. Do not include non-IUPAC characters within the sequence. Use
n's for unknown nucleotides within the sequence.
|
Update features on record without annotation |
If you are adding annotation to a record that has none, then send us the features in one of the two following
formats:
[a] Tab-delimited 5-column Feature table.
For example:
>Feature gb|EFxxxxxx|EFxxxxxx
<1 400 gene
gene ENO1
<1 30 CDS
70 300
product enolase
note homodimer
<1 30 mRNA
70 400
product enolase
<1 30 exon
number 1
70 400 exon
number 2
[b] Spreadsheet:
accession Feature location product number gene note
EFxxxxxx CDS <1..30, 70..300 enolase homodimer
exon <1..30 1
exon 70..400 2
mRNA <1..30, 70..400 enolase
gene <1..400 ENO1
The first line of the table must be the header line. The first column must be the accession number; the second
column must be the Feature type (e.g. CDS); and the third column must be the nucleotide location of the feature.
After the first three columns, feature qualifiers may be listed in any order.
|
Update features on record with annotation |
If you are updating many features of a record, let us know, and we can
send you a tab-delimited 5-column Feature table with the current annotation for you to edit and return
to us.
Or you may send us the revised features in a properly formatted spread sheet as shown above.
|
Network Aware Sequin |
You can use Network aware Sequin to download your existing, public
record from Entrez and make the necessary changes to that file. Network aware Sequin should not be used for simple updates such as publication
changes or source information changes.
Mail the .sqn
file containing the updated version to: gb-admin@ncbi.nlm.nih.gov or submit to us
via UpdateMacroSend.
|
|
Disclaimer
Privacy statement
Revised May 26, 2011
|